ID: 1090897577

View in Genome Browser
Species Human (GRCh38)
Location 11:130992024-130992046
Sequence CATCCCTGCTCCCTAAATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090897577_1090897583 0 Left 1090897577 11:130992024-130992046 CCAAAATTTAGGGAGCAGGGATG No data
Right 1090897583 11:130992047-130992069 GGGAGGTGCCATGACTCTCAGGG No data
1090897577_1090897586 22 Left 1090897577 11:130992024-130992046 CCAAAATTTAGGGAGCAGGGATG No data
Right 1090897586 11:130992069-130992091 GCTCTGGCTTGAGTAACAGAAGG No data
1090897577_1090897587 25 Left 1090897577 11:130992024-130992046 CCAAAATTTAGGGAGCAGGGATG No data
Right 1090897587 11:130992072-130992094 CTGGCTTGAGTAACAGAAGGAGG No data
1090897577_1090897584 6 Left 1090897577 11:130992024-130992046 CCAAAATTTAGGGAGCAGGGATG No data
Right 1090897584 11:130992053-130992075 TGCCATGACTCTCAGGGCTCTGG No data
1090897577_1090897582 -1 Left 1090897577 11:130992024-130992046 CCAAAATTTAGGGAGCAGGGATG No data
Right 1090897582 11:130992046-130992068 GGGGAGGTGCCATGACTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090897577 Original CRISPR CATCCCTGCTCCCTAAATTT TGG (reversed) Intergenic
No off target data available for this crispr