ID: 1090897583

View in Genome Browser
Species Human (GRCh38)
Location 11:130992047-130992069
Sequence GGGAGGTGCCATGACTCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090897577_1090897583 0 Left 1090897577 11:130992024-130992046 CCAAAATTTAGGGAGCAGGGATG No data
Right 1090897583 11:130992047-130992069 GGGAGGTGCCATGACTCTCAGGG No data
1090897572_1090897583 23 Left 1090897572 11:130992001-130992023 CCACAGAAAGCATGAGAGGCAGA No data
Right 1090897583 11:130992047-130992069 GGGAGGTGCCATGACTCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090897583 Original CRISPR GGGAGGTGCCATGACTCTCA GGG Intergenic
No off target data available for this crispr