ID: 1090899705

View in Genome Browser
Species Human (GRCh38)
Location 11:131017662-131017684
Sequence ACTAGGATTTAAAGCAGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090899705_1090899709 2 Left 1090899705 11:131017662-131017684 CCTTCCCTGCTTTAAATCCTAGT No data
Right 1090899709 11:131017687-131017709 TTACTAATAAATGTCCTTTGTGG 0: 35
1: 72
2: 70
3: 88
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090899705 Original CRISPR ACTAGGATTTAAAGCAGGGA AGG (reversed) Intergenic
No off target data available for this crispr