ID: 1090899709

View in Genome Browser
Species Human (GRCh38)
Location 11:131017687-131017709
Sequence TTACTAATAAATGTCCTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 581
Summary {0: 35, 1: 72, 2: 70, 3: 88, 4: 316}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090899705_1090899709 2 Left 1090899705 11:131017662-131017684 CCTTCCCTGCTTTAAATCCTAGT No data
Right 1090899709 11:131017687-131017709 TTACTAATAAATGTCCTTTGTGG 0: 35
1: 72
2: 70
3: 88
4: 316
1090899706_1090899709 -2 Left 1090899706 11:131017666-131017688 CCCTGCTTTAAATCCTAGTGCTT No data
Right 1090899709 11:131017687-131017709 TTACTAATAAATGTCCTTTGTGG 0: 35
1: 72
2: 70
3: 88
4: 316
1090899707_1090899709 -3 Left 1090899707 11:131017667-131017689 CCTGCTTTAAATCCTAGTGCTTA No data
Right 1090899709 11:131017687-131017709 TTACTAATAAATGTCCTTTGTGG 0: 35
1: 72
2: 70
3: 88
4: 316
1090899704_1090899709 3 Left 1090899704 11:131017661-131017683 CCCTTCCCTGCTTTAAATCCTAG No data
Right 1090899709 11:131017687-131017709 TTACTAATAAATGTCCTTTGTGG 0: 35
1: 72
2: 70
3: 88
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090899709 Original CRISPR TTACTAATAAATGTCCTTTG TGG Intergenic
900278209 1:1847088-1847110 TTACTAATAAGTGTCCTTTGTGG - Intronic
900904796 1:5548331-5548353 TTATTAATGAATGTCCTTTGTGG - Intergenic
901708947 1:11099224-11099246 TTACTAATAAACGTGCAATGGGG + Intronic
905779945 1:40699809-40699831 GTGCTAATCAGTGTCCTTTGGGG + Intronic
907878894 1:58524170-58524192 TCATTAATAAATGTCCTTTATGG + Intronic
908275457 1:62466267-62466289 TTAGTAACAAATGTCCATTGTGG - Intronic
908379533 1:63583145-63583167 TTACTAATAAATGTCTTCTGTGG - Intronic
909119142 1:71578619-71578641 TTGCTCATAAATGTCTTTGGGGG + Intronic
909333153 1:74439261-74439283 TGATTAAAAAATGCCCTTTGAGG + Intronic
910173690 1:84404947-84404969 TTACCAATAAGTGTCCTTTGTGG + Intronic
910484363 1:87696526-87696548 TTAGTAATAAATGTCCTTTATGG - Intergenic
911405600 1:97434250-97434272 TTATTAATACATCTTCTTTGGGG - Intronic
911492504 1:98588029-98588051 TTATTAATAAATATCCTCTGTGG - Intergenic
911555873 1:99343780-99343802 TTAATAATATATGTCATGTGAGG + Intergenic
911703847 1:100987907-100987929 TTACTAATACATGGCCATTCTGG + Intergenic
911781430 1:101884526-101884548 TTACTAATAAATGTCCCTTGTGG - Intronic
911789943 1:102001592-102001614 TTATTAATAAATGTCCTTTGTGG + Intergenic
911870611 1:103093448-103093470 TTACTAATAAATATCCTTTGTGG - Intronic
911990623 1:104692661-104692683 TTACTAATAAGTGTCTTCGGTGG - Intergenic
912012885 1:104992593-104992615 TTACTAATACATGACTTTTGTGG - Intergenic
912214580 1:107593485-107593507 TTACTTCTAAAAGTCCTTGGAGG - Intronic
912904660 1:113691459-113691481 TTTCTAATAAATTTCCTTTGTGG - Intergenic
913192076 1:116421239-116421261 TTCCTAATAAATGTCCCTCATGG + Intergenic
913405635 1:118487793-118487815 TTCATCATAAATGTCCTTTTTGG + Intergenic
913423395 1:118698789-118698811 TTACTAATTAATGTACCTTGTGG - Intergenic
913647122 1:120868828-120868850 TTACTAATAAATGACCTTTGTGG - Intergenic
914079520 1:144394037-144394059 TTACTAATAAATGACCTTTGTGG + Intergenic
914174419 1:145262580-145262602 TTACTAATAAATGATCTTTGTGG + Intergenic
914529090 1:148503756-148503778 TTACTAATAAATGACCTTTGTGG + Intergenic
915500530 1:156313460-156313482 TTACTAATAAATGTCATTTGTGG - Intronic
915531788 1:156506746-156506768 GTTGTAATAACTGTCCTTTGGGG + Intergenic
916704770 1:167337806-167337828 TTACTAATCAATGTCCTTTGTGG - Intronic
917071493 1:171156385-171156407 TTATTAATAAATGGCCTTTGTGG - Intronic
917824162 1:178799385-178799407 TTGCTAATATATGTCCTTTGTGG - Intronic
917994472 1:180420910-180420932 TTACTAATAAATGTCCTTTGTGG + Intronic
918129558 1:181613754-181613776 TTACTAATAAATGTCCTTTGTGG + Intronic
918601180 1:186364811-186364833 TTACTAATAAATATCTTTTGTGG - Intronic
918629044 1:186694031-186694053 TTACTAATAAATGTCCTTTGTGG - Intergenic
918670550 1:187210328-187210350 TTACTACTTAGTGTACTTTGAGG + Intergenic
919314721 1:195956525-195956547 CAACTAATAAATGTTCTTTGTGG + Intergenic
919432701 1:197516641-197516663 TTAAAAATAAAGGTCTTTTGTGG + Intronic
919567627 1:199208283-199208305 TTATTAATAAATGACCTCTGTGG + Intergenic
919579216 1:199350308-199350330 TTACTAATAAATGTCCTTTGTGG - Intergenic
919614629 1:199790704-199790726 TTAATAATAATTTTCCTCTGAGG - Intergenic
919967218 1:202539801-202539823 TCAATAAGAAGTGTCCTTTGAGG + Intronic
920151657 1:203914325-203914347 TTACTAATAAATGTCTTTCTTGG - Intergenic
921458327 1:215398115-215398137 TTAATAATAAATGTTCTTTCTGG + Intergenic
921532315 1:216299560-216299582 TTAGTAATAAATGTACACTGTGG - Intronic
922190926 1:223317697-223317719 ATAATAATAAATTTCCTTTTGGG - Intronic
922281127 1:224125380-224125402 TTAATTATAAATGTCAGTTGAGG + Intronic
923164847 1:231350258-231350280 TTTCTAATAAATTCCCCTTGTGG - Intronic
923366061 1:233262752-233262774 TTCCCAATAAATGTCTTTTTGGG - Intronic
923967048 1:239153867-239153889 TTACTATTGATTGTCCTGTGCGG + Intergenic
924018585 1:239755434-239755456 TTAGGAATAAATGGACTTTGAGG - Intronic
1063987311 10:11518789-11518811 TTATTAATAAATGTGGCTTGTGG - Intronic
1064486802 10:15801193-15801215 TTACTTATAAATGTCCTTTATGG - Intronic
1064565285 10:16633257-16633279 TTACAAATAAATGGACTTTTGGG + Intronic
1064595264 10:16938107-16938129 TACTTAATAAATGTGCTTTGGGG + Intronic
1065167386 10:22994121-22994143 TTAAAAAGAAATCTCCTTTGGGG + Intronic
1066668543 10:37812332-37812354 TTAGTAACAAATGTCCTTTGTGG - Intronic
1068063678 10:52101872-52101894 TTACTAATAAATGTCCTTTGTGG - Intronic
1068588325 10:58826436-58826458 TTACTAATAAAAATCCTTTGTGG - Intronic
1068806477 10:61199787-61199809 CCACTAATAAATGTCATTTGTGG + Intergenic
1068883896 10:62078787-62078809 TCCCTAATAAAGCTCCTTTGGGG - Intronic
1069431812 10:68343163-68343185 TTATTAATAAATGTCATTGTGGG + Exonic
1071014150 10:80974867-80974889 TTAGTAATAACTGTTCTTTGTGG + Intergenic
1071816480 10:89237477-89237499 TTACTAATAAACGTCCTTTGTGG - Intronic
1072517274 10:96197736-96197758 TTTCTTATAAAAGTTCTTTGAGG - Intronic
1072545730 10:96436457-96436479 TTACTAAGAAAAGTGCTTTAAGG + Intronic
1072940793 10:99761834-99761856 TTACTGATAAATGTGTTTTGTGG + Intergenic
1073735748 10:106344054-106344076 GTAATATTGAATGTCCTTTGGGG - Intergenic
1078744500 11:14098338-14098360 TTACTATTCAATCTCTTTTGTGG + Intronic
1080121842 11:28686862-28686884 TTACTAATAAATGTCCTTTGTGG + Intergenic
1080124425 11:28715594-28715616 TTACTTATTAATGTCCTTGATGG - Intergenic
1080149647 11:29035987-29036009 TAACTAACAAATGTCCTCTGTGG - Intergenic
1080638511 11:34144093-34144115 TAACCAACAAAAGTCCTTTGGGG - Intronic
1081156007 11:39691811-39691833 TTACTAATAAATATATTTTGTGG - Intergenic
1081279646 11:41192987-41193009 TTACCATCAAATGTTCTTTGTGG - Intronic
1081428913 11:42954786-42954808 TTGCTAATAAATGTCATCAGAGG + Intergenic
1081949787 11:47034405-47034427 TTACTAATAAGTGTCCTTTGTGG + Intronic
1082233981 11:49800293-49800315 TTACTAATAAATGTTCTTTGTGG - Intergenic
1082596022 11:55083443-55083465 TTACTCCCAAATATCCTTTGTGG + Intergenic
1083010562 11:59394140-59394162 GTATTAATAAATGTCCTTCGTGG - Intergenic
1083066173 11:59925933-59925955 TTACTGATAAATGTCCTACCTGG + Intergenic
1084158708 11:67332146-67332168 TTACTAAGAAAGGTCTTTTGTGG - Intronic
1085489549 11:76902024-76902046 TTACTAATAAATGTCCCTTGTGG + Intronic
1085689319 11:78652538-78652560 ATTCAAATAATTGTCCTTTGAGG - Intergenic
1085871977 11:80360937-80360959 TTCCTAATAAATGTCATTTGTGG + Intergenic
1086285048 11:85238016-85238038 TTACTAGTAAATATTCTTTGTGG + Intronic
1086536318 11:87851198-87851220 TATCAAATAAATGTCCTTTGGGG - Intergenic
1086617610 11:88841147-88841169 TTACTAATAAATGTTCTTTGTGG + Intronic
1086863195 11:91949130-91949152 TTACTAATACATGTCCTTTCAGG - Intergenic
1087244964 11:95824684-95824706 TTACTTATAAATATCCTTCGTGG - Intronic
1087281326 11:96214225-96214247 TTTCTAATATAGGTCTTTTGAGG + Intronic
1087414881 11:97841296-97841318 TTACTAATAAATGTCCTTCATGG + Intergenic
1087838607 11:102899435-102899457 ATAATAATAAATGTCTTTGGAGG - Intergenic
1088015364 11:105051961-105051983 TTACTAACAAATGGCCTTTTTGG + Intronic
1089037426 11:115409348-115409370 TTCTTAAGAAATCTCCTTTGAGG - Intronic
1089174053 11:116535770-116535792 TTATTACTAAAAGTGCTTTGAGG + Intergenic
1089836523 11:121375383-121375405 TTACTAATAATTGTCCTCATTGG + Intergenic
1090122222 11:124042669-124042691 TTGCTATTCAAAGTCCTTTGCGG + Intergenic
1090899709 11:131017687-131017709 TTACTAATAAATGTCCTTTGTGG + Intergenic
1093527433 12:20118267-20118289 CTAATTATAAATGTCCTCTGAGG + Intergenic
1093588071 12:20866742-20866764 TCATTAATAAGTGTACTTTGTGG - Intronic
1093601317 12:21027688-21027710 TTATTAATAAGTGTACTTTGTGG - Intronic
1093613110 12:21187112-21187134 TTATTAATAAACGTCCTTCGTGG - Intronic
1093696946 12:22171424-22171446 TTTCTCATTAATGTCCTTTTTGG - Intronic
1094087671 12:26611287-26611309 TAACTAAAAAATGTCCCTAGGGG - Intronic
1097098865 12:56571888-56571910 TTAATAACAAATGTCACTTGGGG + Intronic
1097332657 12:58349217-58349239 TTACTAATAAGTGTTCTTTGTGG - Intergenic
1097452074 12:59749108-59749130 TTACTAATAAATTTCCTTTGTGG - Intronic
1097564136 12:61247533-61247555 TTACTAATACATGTCCTTTATGG - Intergenic
1097710810 12:62915024-62915046 TTACTAAAAAAAATTCTTTGTGG + Intronic
1098039766 12:66341965-66341987 GGACTACTAAGTGTCCTTTGAGG + Exonic
1098391871 12:69978118-69978140 TTGCTTATAAATGTGCTTTGGGG + Intergenic
1098398619 12:70049535-70049557 TTAGTAATAAAAGCCCTTGGTGG - Intergenic
1098542479 12:71672149-71672171 TTACTAATACATATCCTTTGTGG + Intronic
1098772594 12:74573188-74573210 TTACTAATAAATGCCCTTTGTGG - Intergenic
1098839431 12:75461083-75461105 TTAGTAATAAATTCCCTTTGTGG - Intergenic
1099102780 12:78463072-78463094 TTACAAATAAATGTGCTTATTGG + Intergenic
1099418095 12:82419213-82419235 TTATTAATAAGTGTTCTTTGTGG - Intronic
1100536086 12:95510609-95510631 TTCCCAATACATGACCTTTGGGG + Intronic
1100969289 12:100050306-100050328 TCATTAATAGATGTCCGTTGTGG - Exonic
1101472039 12:105006749-105006771 TTACTAATTGATGTCTTTTGTGG + Intronic
1102311766 12:111850678-111850700 TTACTCATAAATGTCCTTTGTGG - Intronic
1104788113 12:131464171-131464193 TTACTAATAAATGTCATTTGTGG - Intergenic
1107136086 13:36945483-36945505 TTCCTAATAAATGTCCTTTGTGG + Intergenic
1107539201 13:41370374-41370396 TTACTAATAGATGTCCTTTGTGG - Intronic
1107887550 13:44886372-44886394 TTACTTCTCAATCTCCTTTGAGG - Intergenic
1108049934 13:46423546-46423568 TGACAAATAAATCTCCTTGGAGG - Intronic
1108389243 13:49931611-49931633 TTACTTATAAATGTTCTCTTAGG - Intronic
1108401744 13:50051919-50051941 TTACTAATAAATGTCCTTTGTGG - Intergenic
1108450355 13:50556447-50556469 TTACTAATAAATGTCCTTTGTGG - Intronic
1108853341 13:54762851-54762873 GTACTGATAAATGGGCTTTGGGG + Intergenic
1108918907 13:55653340-55653362 GTAATAAGAAATGTCCTGTGTGG + Intergenic
1109403178 13:61861805-61861827 TTACAAATAAATCTCCAGTGTGG - Intergenic
1109542453 13:63796833-63796855 TGACAAATAAATCTCCTTGGAGG - Intergenic
1109555169 13:63964614-63964636 ATACTAATAAAATTCCTTTGGGG + Intergenic
1109842737 13:67941148-67941170 TTAATAATAAATTACCTTTCTGG - Intergenic
1109989655 13:70038403-70038425 TTACTGATAAATGTCCTGGAGGG + Intronic
1110559608 13:76896630-76896652 TTACTAAGAAATGTCCTATGTGG + Intergenic
1110563206 13:76931327-76931349 TTACTAATAAATGCCCTTTGTGG + Intergenic
1110743104 13:79019964-79019986 TTATTAATAAATTTCAATTGGGG - Intergenic
1110948775 13:81458742-81458764 AGACTAATAAATGTAATTTGAGG + Intergenic
1111495650 13:89045885-89045907 TTCTTAATAAATGTCCTTTGTGG + Intergenic
1111963862 13:94840806-94840828 TTAACACTAAATGTCCTTGGGGG - Intergenic
1112067417 13:95808387-95808409 TTACAAATAAATGTCCTTTGTGG + Intronic
1112193102 13:97197059-97197081 TGAATAATCAATGTCTTTTGAGG - Intergenic
1112400550 13:99073722-99073744 TTACTAAAAAATGTCCTTTGTGG + Intronic
1112542170 13:100325551-100325573 CTACTAAGAAATGTTCCTTGTGG - Intronic
1112708008 13:102094518-102094540 TTACTAAGAAATGTCCTTTGTGG - Intronic
1112838972 13:103552251-103552273 TTACTAATAAACTTCCTTTTTGG - Intergenic
1115283376 14:31690104-31690126 TTACTAATAAGTGTCCTCTGTGG - Intronic
1115596132 14:34910739-34910761 TTACTTAAACATGTTCTTTGAGG + Intergenic
1115613801 14:35073839-35073861 TTACTAATAAATGTCTTTTGTGG + Intronic
1115735655 14:36326218-36326240 TTAGTATTAAGTCTCCTTTGGGG - Intergenic
1115935709 14:38549803-38549825 TTCCTGATAACTGTTCTTTGTGG + Intergenic
1116129613 14:40838290-40838312 TAACAAATAAATGTCCTTTGTGG - Intergenic
1116235812 14:42278147-42278169 TTATTAAAAAATGTGTTTTGAGG - Intergenic
1116520214 14:45837278-45837300 TTACTAGTAAATGTCCTTCGTGG + Intergenic
1117047141 14:51824889-51824911 TTACTATTAAATATACTATGAGG + Intergenic
1117365410 14:55022408-55022430 TTACTAATAAATGTTCTTTGTGG + Intronic
1117545135 14:56787677-56787699 TTACTATTAAATGACCTGTTAGG - Intergenic
1117639496 14:57783411-57783433 TTACTAATAAATGTCCTTTGTGG - Intronic
1118405792 14:65422407-65422429 TTACTAATGAATGTTTTTTATGG + Intronic
1118970131 14:70629264-70629286 TTACTAATAAATGTCCTTTGTGG - Intergenic
1120150198 14:81023874-81023896 TTACTAATAAATGTCCTTCATGG + Intronic
1120366572 14:83579006-83579028 TTACTTATAAAAGTCCTTTTAGG + Intergenic
1120508416 14:85381860-85381882 TTACTTATGTATCTCCTTTGGGG - Intergenic
1120707974 14:87763972-87763994 TTTCTAACACATGACCTTTGGGG + Intergenic
1120901939 14:89583238-89583260 TTTCTAATAAATGAATTTTGAGG - Intronic
1121527562 14:94629842-94629864 TCACTAATAAGGGTCCCTTGGGG + Intergenic
1121613955 14:95300266-95300288 TTACTCATCTATGTGCTTTGGGG - Intronic
1122298612 14:100719351-100719373 TGACCATAAAATGTCCTTTGAGG - Intergenic
1122394436 14:101413252-101413274 TGATCTATAAATGTCCTTTGAGG + Intergenic
1123927313 15:25129167-25129189 TTACTAATAAATGTCCTTTCTGG + Intergenic
1124940984 15:34217649-34217671 CCACCAATAAAGGTCCTTTGGGG - Intergenic
1124967148 15:34442764-34442786 TTCCTAATACATGAACTTTGGGG + Intergenic
1125311559 15:38384814-38384836 TTACTAATCAATGGCCCTTGTGG - Intergenic
1125383940 15:39115962-39115984 TTACTAATAAATGTCATCTATGG + Intergenic
1125814615 15:42574364-42574386 TTACTAATAAATGTCCTTTGTGG - Intergenic
1125978984 15:43982570-43982592 TTACTAAGAAGTGTCCTTTGTGG + Intronic
1126817819 15:52471249-52471271 TTACTAGTAAATGTCTTTTGTGG + Intronic
1127643816 15:60940261-60940283 TTACCAATTGATGGCCTTTGGGG - Intronic
1127854846 15:62945848-62945870 TTAATAAGAAATTTCCTTTGGGG - Intergenic
1128139604 15:65289488-65289510 TTACTAATAAGTGTCTTTTGTGG - Intronic
1129008414 15:72394628-72394650 ATGCTGATACATGTCCTTTGGGG + Intergenic
1131145167 15:90006315-90006337 AAACTAAGAAATGTCCTTTTTGG + Intronic
1134429025 16:14183735-14183757 TTTTTAATAAATGTTCTTTCAGG + Intronic
1135870475 16:26145259-26145281 TTACCATTAAATGTCTTTAGAGG + Intergenic
1137229002 16:46544273-46544295 CCACTAATAAATGTCCTTTTTGG - Intergenic
1138590112 16:57995178-57995200 TTAATAATAAAGGTCCTTCTGGG + Exonic
1139202266 16:64990055-64990077 TTAAAAAAAAATGTCCTATGTGG + Intronic
1139784316 16:69379153-69379175 TTGTTAATAAATGTGCTTTCTGG - Intronic
1140703489 16:77604427-77604449 TTACTAATTCATGTTGTTTGGGG - Intergenic
1141166614 16:81665046-81665068 TAACGACTAAATGTCATTTGGGG + Intronic
1142320144 16:89376794-89376816 TTACTAACAAATGTTCTTACAGG - Intronic
1142654037 17:1378131-1378153 TTACTAAGAAATTTACCTTGCGG + Intronic
1143803548 17:9405648-9405670 TTACTAGTAAATGTCATGTTTGG + Intronic
1145699157 17:26814861-26814883 TTTCAAATAAATTTCATTTGAGG - Intergenic
1145875043 17:28311921-28311943 TTACAAAAAAATGTCCTTAATGG - Intergenic
1146568060 17:33930295-33930317 TTACAAATATACGGCCTTTGAGG - Intronic
1147126510 17:38373432-38373454 TTACTAATAAATATCCTTTGTGG - Intronic
1147398427 17:40163569-40163591 CTGTTAATAAATGTCCTTGGTGG - Exonic
1148406155 17:47418292-47418314 CTACTAATAAATGTCCTTTTTGG + Intronic
1148543143 17:48496083-48496105 TCACTGATAAATGCCCTATGTGG + Intergenic
1148949837 17:51301136-51301158 TTAATAAGAAATGTACATTGAGG - Intergenic
1149710437 17:58736967-58736989 TTACAATAAAATGTGCTTTGAGG - Intergenic
1149926163 17:60704251-60704273 TTACTAATAAATGTCTTTTGTGG - Intronic
1150892288 17:69166855-69166877 CTACTAATCAGTGTCCTTTGTGG - Intronic
1153038765 18:790397-790419 TTACAAATAAAAATCCTTTTGGG - Intronic
1153052914 18:917130-917152 ATAGTAAGAAATATCCTTTGAGG + Intergenic
1153409238 18:4775508-4775530 TTACTACTAAATCTTCTTTGTGG - Intergenic
1153440212 18:5108810-5108832 ACCCTAATAAATGTCATTTGAGG + Intergenic
1153659325 18:7312702-7312724 TTACTAATAAATGTGCTTTGTGG + Intergenic
1153861546 18:9215191-9215213 TTACTAATAAATGTCCTTTGTGG - Intronic
1155302215 18:24440627-24440649 TTACTAACTAATTTCTTTTGAGG + Intronic
1155569790 18:27180364-27180386 TTATTTATAAATGACTTTTGAGG + Intronic
1155758937 18:29540203-29540225 TTACTAATAGATATCCTTAGTGG - Intergenic
1155789469 18:29947324-29947346 TTACTAATAAATACCCTTTGTGG + Intergenic
1156107170 18:33677110-33677132 GTTTTAATAAATGTCCTTGGTGG + Intronic
1157045972 18:44102416-44102438 CTATTCATAAATGTCCTTTGTGG - Intergenic
1157151101 18:45219436-45219458 TTAATAATCAGTTTCCTTTGTGG - Intronic
1157398887 18:47369387-47369409 TTATTAATAAATGTCCTTTGTGG + Intergenic
1157462250 18:47909511-47909533 TTGCTAATAAATGTCCTTTGTGG - Intronic
1159066941 18:63580605-63580627 TTACTAATACATGTCATTTACGG - Intergenic
1159476444 18:68926668-68926690 TTAATAATAAAAATCATTTGTGG - Intronic
1160227205 18:77020386-77020408 TTACTGAAAGAGGTCCTTTGTGG - Intronic
1160656423 19:273751-273773 TTAATCATAAATGTTCTTAGTGG - Intergenic
1161816041 19:6500836-6500858 TTACTTATTTATCTCCTTTGTGG + Intronic
1164774937 19:30845493-30845515 TGACTAATAAAAGTTCCTTGAGG + Intergenic
1165877593 19:39020104-39020126 TTACTAATAAATGTCCTTTGAGG - Intronic
1168576993 19:57520360-57520382 TTACTAATAAATGTCCTTTGTGG - Intergenic
925004564 2:431079-431101 TTACAAATAATTCACCTTTGTGG - Intergenic
926214782 2:10898248-10898270 TTAATAATTACTGTCATTTGTGG - Intergenic
926665843 2:15522047-15522069 TTAGTATTAAAGGCCCTTTGTGG - Intronic
926831396 2:16966307-16966329 TTTCTAACACATGACCTTTGAGG - Intergenic
926935098 2:18079162-18079184 TTACTAGTAAATGTCTTTTCAGG + Intronic
928274230 2:29884895-29884917 TTACTCATAAATGTGCTTTGTGG - Intronic
929161309 2:38835217-38835239 TTACTAATAAATGTCCTTTGTGG - Intronic
929355757 2:41022330-41022352 TTAGTAATAAATGTCCTTTGTGG - Intergenic
930076798 2:47412466-47412488 GTCCTGATAAATGTCTTTTGTGG - Exonic
930937907 2:56979171-56979193 TAACTAATAAATGTCTTTTGTGG - Intergenic
931529367 2:63196771-63196793 TTACTAATAAATGTCCTTTGTGG - Intronic
931596487 2:63950759-63950781 TTGCTAATAAATGTTCTTTGTGG + Intronic
932059213 2:68478734-68478756 TTACTAATAACTGTCCTTTGTGG - Intronic
932319017 2:70807280-70807302 TTACTAACAAATGTCCTTTGTGG - Intergenic
932906660 2:75760960-75760982 TTACTATTAAAAATACTTTGTGG - Intergenic
932990677 2:76781769-76781791 TTATTGATAAATTTCCTTTGTGG + Intronic
933246530 2:79981801-79981823 TAACTAATGTATGTCCTTTCTGG + Intronic
933566752 2:83959609-83959631 TTATTAATATTTCTCCTTTGTGG - Intergenic
933640595 2:84755094-84755116 TTTCTAATAAAGGAACTTTGGGG - Intronic
934952584 2:98588069-98588091 ATACCAATAAATGTTATTTGGGG + Exonic
935473557 2:103489683-103489705 TTACTAATAAGTGTTCTTTGTGG - Intergenic
936420401 2:112358389-112358411 TTATTAACAATAGTCCTTTGTGG + Intergenic
937162202 2:119775127-119775149 TTACTAATAAATGTCCTTTGTGG - Intronic
937549120 2:123064862-123064884 TTACTGATAAATGTCTCTTGGGG + Intergenic
937768318 2:125688175-125688197 TTTCTAGTAAATGTCCTTTGTGG - Intergenic
937821857 2:126319132-126319154 TCCCTAATAAATATCCTTTAAGG + Intergenic
937953213 2:127404295-127404317 TAATTAATAAATGTCCTGTGGGG - Intergenic
938556986 2:132434161-132434183 TTACTAATAAACGTCCTTCATGG - Intronic
939439941 2:142234173-142234195 TTACAAATAAATTTCCTATAGGG - Intergenic
939853258 2:147325500-147325522 TTACTAATACGTGTCCTTTCTGG - Intergenic
940481608 2:154240376-154240398 TTACTAATCAGTGTGCTCTGGGG + Intronic
940865627 2:158815091-158815113 TTACTCATAGATGTCTTCTGTGG + Intronic
940921405 2:159311663-159311685 TTACTAAAAAATGTCATTTAAGG - Intergenic
941844509 2:170119835-170119857 TAACTTATCAATGTCCTTTATGG + Intergenic
941937987 2:171001662-171001684 TTACAAATAAATGTCCTCCGTGG + Intronic
943252935 2:185552810-185552832 TTATTAATAAATGTTTTTTGAGG - Intergenic
943422255 2:187680753-187680775 TCATTAATTAATGTACTTTGTGG - Intergenic
943954459 2:194170346-194170368 TTAATAATAAATGTATTTTGTGG - Intergenic
944734623 2:202550890-202550912 TTATTATCTAATGTCCTTTGAGG + Intronic
944786416 2:203075183-203075205 TTTCTAATATATTTCCTTTATGG + Intronic
945491879 2:210465868-210465890 TTACTAATGCATGTCCTTTGTGG - Intronic
946718889 2:222583288-222583310 TAATTAATAAATGTCTTGTGGGG - Intronic
946724302 2:222647118-222647140 TTGCTTATAAATTTCCTTTCTGG + Intronic
946919741 2:224566472-224566494 TTACTAGTCAATATCCTTTGTGG + Intronic
947005967 2:225511694-225511716 TGACAATTACATGTCCTTTGGGG - Intronic
947888879 2:233597940-233597962 TTACTAATAAATGTCCTTTGTGG + Intergenic
947894863 2:233660718-233660740 TTACTTATAAATGTCTTTTGTGG + Intronic
1170227810 20:14011432-14011454 TTAATAATGAATGTCTTTTGTGG + Intronic
1170297627 20:14845863-14845885 TTCCTAAAAAATGCCGTTTGGGG - Intronic
1170359102 20:15524974-15524996 TTACAACTAAATGTTCTTTCTGG + Intronic
1171949618 20:31409342-31409364 TTACTAATTAATGGACTTTTGGG - Intronic
1174564836 20:51457168-51457190 CTGCTAATAAATCTCATTTGTGG - Intronic
1174665111 20:52250762-52250784 TTACAAATAATTGTTTTTTGGGG + Intergenic
1174682147 20:52419089-52419111 TTTCTAACATATGACCTTTGGGG - Intergenic
1174763885 20:53233513-53233535 TTTCTCATAAATGTCCTCAGTGG + Intronic
1177520313 21:22213501-22213523 TTACTGATGATTGTCCTTTTTGG + Intergenic
1178868978 21:36355592-36355614 TTGCTAATAAGTGTTCTTTGTGG + Intronic
949400469 3:3660284-3660306 TTTCTAATACATGAACTTTGGGG + Intergenic
951949908 3:28188455-28188477 TGACTAAGAAATGTCCTTTGTGG - Intergenic
952148266 3:30557716-30557738 TTAAAAATAGCTGTCCTTTGTGG - Intergenic
952520274 3:34149999-34150021 TGACTTGTAAATTTCCTTTGTGG + Intergenic
952732028 3:36648828-36648850 TTACTCATAAGTGACATTTGTGG - Intergenic
953185881 3:40638067-40638089 TTACCAAAAGATGTCTTTTGTGG + Intergenic
953279342 3:41537899-41537921 CTAATAAGGAATGTCCTTTGTGG + Intronic
953279399 3:41538808-41538830 CTCCCCATAAATGTCCTTTGTGG + Intronic
953379692 3:42459478-42459500 TTACTAATAAATGCCCTTTGTGG + Intergenic
953778878 3:45847835-45847857 TTATGAATAAATGTCCTTTGTGG + Intronic
953808732 3:46093949-46093971 TTGCTAATAAATGTCTGTTTTGG - Intergenic
954645176 3:52126920-52126942 TTTCTAATACATGAACTTTGGGG + Intronic
955382665 3:58452564-58452586 TTACTAATAAATGTTCTTTGTGG + Intergenic
956361832 3:68456335-68456357 TTACCAATAAATGTCCTTTGTGG + Intronic
957292294 3:78293330-78293352 TTGCTAATTAATTTCCTTTATGG - Intergenic
957569719 3:81930872-81930894 TTTTAAATAAATGTCCTTTAGGG + Intergenic
958713391 3:97746773-97746795 TTATTAATATCTGTGCTTTGGGG + Intronic
958807443 3:98829041-98829063 TAACTAAGGAATTTCCTTTGGGG + Intronic
959261890 3:104092618-104092640 TTTCAAATAAATGACCTATGGGG - Intergenic
959922202 3:111880656-111880678 TTACTAGTGAATGTCCTTTGTGG + Intronic
959969126 3:112389060-112389082 TTACTAGTAAATATCTTTTGTGG - Intergenic
961988988 3:131167578-131167600 TTATAAATCAAGGTCCTTTGGGG + Intronic
962545270 3:136428098-136428120 TTACTAATAAGTGTCCTTTGTGG - Intronic
962783686 3:138745889-138745911 TTCCTAATAAATGACCTTTGTGG + Intronic
963031765 3:140985828-140985850 TTACTAATTAATGTCTTTTGTGG - Intergenic
963136550 3:141910697-141910719 TTACTCCCAACTGTCCTTTGGGG + Intronic
963425746 3:145120482-145120504 TACCTAGAAAATGTCCTTTGGGG + Intergenic
963505182 3:146176055-146176077 TTACAAATAAAAGGTCTTTGGGG - Intergenic
964297378 3:155248793-155248815 TTACTAATACATGTCCTTTGTGG + Intergenic
964538048 3:157747276-157747298 TTACTAATGAATGTCCTTTGTGG + Intergenic
964556295 3:157943279-157943301 TTACTAAAAAATGGCATGTGAGG - Intergenic
964791595 3:160458222-160458244 TTACTAATACATGTCCTTTGCGG - Intronic
965069370 3:163898554-163898576 TTACTAATAAGTTTCCATAGTGG - Intergenic
965347337 3:167568083-167568105 TTATTAATAAACATCCTTTGTGG + Intronic
965357975 3:167700924-167700946 TTACTAATAAATATTCTTTGTGG - Intronic
965518470 3:169648059-169648081 TTACTAATAACTTTCCTAAGAGG - Intronic
966455801 3:180114614-180114636 TGACTGAGAAATGTCATTTGAGG - Intergenic
966456732 3:180126336-180126358 TTGATAATAAATGTCCTTTATGG - Intergenic
967801428 3:193666479-193666501 TTTCTAATAAATCTACTTTTGGG - Intronic
968034429 3:195534420-195534442 TTATAAATAAATGTCCTTTGTGG - Intronic
968806054 4:2773309-2773331 TTTCTAATACATGAACTTTGAGG + Intergenic
970397806 4:15687924-15687946 TTACTAATAATGGTGCTGTGTGG + Exonic
971084224 4:23251552-23251574 TTACTAATAAATGTCTATGTTGG + Intergenic
971436702 4:26633688-26633710 TTACTAATGAAAGTCCTATGTGG + Intronic
971621655 4:28861716-28861738 TTACTAATAATTGTTCTTTGTGG + Intergenic
971732488 4:30403777-30403799 TTACTAATAAATGTCCTTTGTGG - Intergenic
971870012 4:32222619-32222641 TTACAAATTAATGATCTTTGTGG + Intergenic
971966646 4:33566963-33566985 TTACTAGAAAATTTCTTTTGAGG + Intergenic
974228197 4:59076407-59076429 TTATTCATAAACGTCCTTTTTGG + Intergenic
974874926 4:67692339-67692361 TTACTAATAAATGTCCTTTGTGG - Intronic
975273055 4:72460848-72460870 TGACTAATAAATTTCTTTTTGGG + Intronic
975574447 4:75848851-75848873 TTACTATTCAATATCTTTTGGGG - Intergenic
976245193 4:83000243-83000265 TCACTAATAAATGTCTTTTATGG - Intronic
976361648 4:84185602-84185624 GAACTAAATAATGTCCTTTGCGG - Intergenic
976976454 4:91170707-91170729 TCACTAATAAAGGTCATTTATGG - Intronic
976983169 4:91257757-91257779 TTAGTATTAAATGCCCTCTGTGG + Intronic
977317543 4:95469135-95469157 TTACCAGTAAATTTCTTTTGCGG + Intronic
977339168 4:95735720-95735742 TTACTAATAAATGTCCTTTATGG + Intergenic
977935569 4:102799586-102799608 AAACTAATAAAAGTCTTTTGAGG - Intronic
978150157 4:105424976-105424998 TCACTAATGAATGCCCCTTGTGG - Intronic
978420288 4:108525546-108525568 CTATTAATAAATTTCCTTTGTGG - Intergenic
979016052 4:115435095-115435117 TCACTAATAAATGTTCTTTGTGG - Intergenic
979132548 4:117065779-117065801 TTACTTATAAAAGTACTTTATGG + Intergenic
979143031 4:117202411-117202433 TTACTCAAAAATGTATTTTGGGG - Intergenic
979465656 4:121035183-121035205 TTACTAATAAAAGTCCTGATTGG + Intergenic
979683803 4:123489146-123489168 GTTCTAACAAGTGTCCTTTGTGG - Intergenic
980275099 4:130640329-130640351 TTACTAAAAATTGTCCTCTGGGG - Intergenic
980559195 4:134450308-134450330 TTCCTAATATTTGTCATTTGTGG + Intergenic
980916082 4:139034327-139034349 TTTCTAATACATGAACTTTGGGG + Intronic
981056189 4:140364483-140364505 TTACTAATAAATGTCCTTTGTGG - Intronic
981170525 4:141617415-141617437 TGACTAATAAATGTCCTTTGTGG + Intergenic
981175297 4:141676018-141676040 TTACTAATAAATGTCTTCTGTGG - Intronic
981487922 4:145307135-145307157 TTACTAATGCATGTCCTTTGTGG - Intergenic
981571586 4:146157467-146157489 TTACTAATAACTGTCCTTTGTGG - Intergenic
981913703 4:150011000-150011022 TTGCTAATTAATGTCTGTTGTGG - Intergenic
981983515 4:150826332-150826354 TTGCTAATAAATATCCTTTGTGG - Intronic
982153757 4:152494472-152494494 TTTTTTTTAAATGTCCTTTGAGG + Intronic
982425541 4:155254268-155254290 TTACTAATAAATGTCCTTTGTGG + Intergenic
983039597 4:162909835-162909857 TTACTAATAAATGTCCTTTGTGG - Intergenic
983206488 4:164915746-164915768 TTGCTTATAAATTTCCTTTCTGG - Intergenic
983212135 4:164969800-164969822 TTGCTTATAAATTTCCTTTCTGG + Exonic
983248709 4:165320154-165320176 TTCCTAATAAATGTCCCTGGTGG - Intronic
983465692 4:168086367-168086389 TTACTAATAAAGATGATTTGGGG - Intergenic
983610801 4:169642821-169642843 TTAATAATAAAAGCCCTGTGAGG - Intronic
984304668 4:177973267-177973289 TTATTTATAAATGTACTTTCTGG - Intronic
984419965 4:179508140-179508162 TTATTAATACATGTCCTTTGTGG + Intergenic
984695054 4:182770694-182770716 TTACAAATGAGTGTCCTGTGAGG - Intronic
984729430 4:183053720-183053742 TTACTAATGAATATCCTTTGTGG - Intergenic
985223344 4:187731658-187731680 TTACTAATAAATTTCCTTTGCGG - Intergenic
985562284 5:594501-594523 TGACTAATCAGTGGCCTTTGGGG - Intergenic
986409970 5:7467591-7467613 TTCCTGATAAATGGCTTTTGTGG + Intronic
987227374 5:15856882-15856904 TTACTAATAAATGCATATTGCGG + Intronic
987466657 5:18279971-18279993 TTACTAATAAATGCTCTCTTGGG + Intergenic
987612331 5:20222276-20222298 TAACTATTAGATTTCCTTTGTGG - Intronic
987964006 5:24848686-24848708 TTACTAATATACGTCCTTGGTGG + Intergenic
988880905 5:35500952-35500974 TTATTAATTTATGTCCTTTATGG + Intergenic
989308450 5:39984787-39984809 ATCTTAATAAATGTCCTTTGTGG - Intergenic
989341978 5:40386403-40386425 TTATTAAAAAATGTGGTTTGTGG - Intergenic
989462512 5:41716833-41716855 TTACTAATAAATTTCTTTTGTGG + Intergenic
989731969 5:44659673-44659695 TTATTAATAAATGCCTTTTGTGG + Intergenic
989978374 5:50612211-50612233 TTATGAATAAATGTCCTTTGGGG - Intergenic
991650887 5:68852073-68852095 TTACTAATAAATGTCCTTTGTGG - Intergenic
992127019 5:73652660-73652682 GTACTTATAAATGACCTTTTCGG - Intronic
992294197 5:75310841-75310863 CTACCAAAAAATGTCATTTGAGG - Intergenic
992717799 5:79528624-79528646 TTTCAAATAAATTTGCTTTGTGG - Intergenic
992918752 5:81489410-81489432 TCACAAATCAATGTACTTTGAGG + Intronic
993261748 5:85666517-85666539 TTACTAATAAATGACCTTGGTGG - Intergenic
993873130 5:93274883-93274905 TTACTGATAAATTTGCTGTGAGG - Intergenic
993929538 5:93921602-93921624 TTACTAATAAATGTCTTTTGTGG - Intronic
994032247 5:95156971-95156993 TTGCTAAGAAATGTGATTTGAGG + Intronic
994501500 5:100584319-100584341 GTATTAATAAGTGTCATTTGTGG + Intronic
994601190 5:101907516-101907538 TTATTAATAAATATCCTTCGTGG - Intergenic
994906188 5:105843099-105843121 TTGCTAATAATTGTACTTTTTGG - Intergenic
995327885 5:110912227-110912249 TTACCAATAAATGTTCTCTGTGG + Intergenic
995463279 5:112424675-112424697 CTTCAAATAAATGTTCTTTGGGG + Intergenic
995721634 5:115140828-115140850 ATTCTAATATATGTCTTTTGGGG + Intronic
995789075 5:115864021-115864043 TTACTAAAAAATATCTTTTGTGG - Intronic
995830666 5:116351537-116351559 ATAATAATAAATTTTCTTTGTGG + Intronic
996236034 5:121130304-121130326 ATACTAATATATGACCTTTTAGG - Intergenic
996614799 5:125428534-125428556 TTAAAAATAAATGTATTTTGTGG - Intergenic
996991706 5:129641001-129641023 TCACTTTTAAATGTCCTTTATGG + Intronic
997165479 5:131656770-131656792 TTACTAATAAATGTACTTTGTGG - Intronic
997913602 5:137901425-137901447 TTATTAATCAATGTTCTTTGTGG - Intronic
999515694 5:152299432-152299454 CCACTAATATATGTTCTTTGAGG + Intergenic
999552388 5:152703643-152703665 TTACCAACAAATATCCTTTGGGG - Intergenic
1000013941 5:157260789-157260811 TTACTAAGCAATGTTCTTTGTGG + Intergenic
1000034238 5:157431100-157431122 TTACTAATAAATGTCCTCTGTGG - Intronic
1000545179 5:162591400-162591422 TTTCTAATACATGAACTTTGGGG - Intergenic
1001357339 5:171041497-171041519 GTTCTAAGAAATGTCCTTTTAGG + Intronic
1002550427 5:179985804-179985826 TTACTAATAAATGTCCTTTGTGG + Intronic
1003252923 6:4447729-4447751 ATACAAATAAATGTGCTTTCTGG + Intergenic
1003344123 6:5250080-5250102 TTACTTATAATTGTACTTTTTGG + Intronic
1003765633 6:9233291-9233313 TTAGTAATAAATGTCCTTTGTGG - Intergenic
1004575988 6:16895489-16895511 TTACTAATAAATGCCATTGGGGG - Intergenic
1004840564 6:19579451-19579473 CTACTAATAAATGTCCTTTGTGG - Intergenic
1006616083 6:35327944-35327966 CTACTAATAAATTTCTTTTCTGG - Intergenic
1007732673 6:43958301-43958323 TTATTAATAACTGTTCTTTGTGG - Intergenic
1008416261 6:51244345-51244367 TTACTAAGAAATATCATCTGAGG + Intergenic
1008676044 6:53819797-53819819 TGGCTAATAAATCTCATTTGAGG - Intronic
1008855972 6:56087762-56087784 TTACTAATAAATGTCCTTTGTGG + Intronic
1009043191 6:58206499-58206521 TTTCTCATACATGTACTTTGGGG + Intergenic
1009056692 6:58344817-58344839 TTACTAATAAATGCCCTATAGGG - Intergenic
1009219032 6:60960747-60960769 TTTCTCATACATGTACTTTGGGG + Intergenic
1009234551 6:61106755-61106777 TTACTAATAAATGCCCTATAGGG + Intergenic
1009463426 6:63941636-63941658 TTACTAATAAGTGTCCTTTGTGG - Intronic
1009541953 6:64971312-64971334 ATGCTAATGAATGTCCTTTGTGG - Intronic
1010041522 6:71390362-71390384 TTTCTAAGAAATTTCCTATGGGG + Intergenic
1010107293 6:72184779-72184801 TTACTACTAAATGTCCTTTTTGG - Intronic
1010728282 6:79360383-79360405 TTACTAATTAATGTCATTCATGG + Intergenic
1010735554 6:79440012-79440034 TTTCTTATAAATGGCCTTTTTGG - Intergenic
1010828528 6:80502434-80502456 TTAGTAATAAATGTCCTTCTTGG - Intergenic
1011920210 6:92565134-92565156 TTACTAATAAATATCCTCTGTGG - Intergenic
1011968722 6:93194651-93194673 TTACAAAGAAAAGTACTTTGAGG + Intergenic
1012032677 6:94092670-94092692 TTTCTAATAAATGTCATTTAAGG - Intergenic
1012096782 6:94972319-94972341 TTAGCAATAGATGTCCTTTGTGG + Intergenic
1012286938 6:97401969-97401991 TTGCTAATAAATGCTCTTTGTGG + Intergenic
1012409388 6:98938726-98938748 TTAATAATAAATGTCTTTTGTGG + Intronic
1013363433 6:109416177-109416199 TTACTAATAAATGTCTTTTGTGG + Intronic
1013504577 6:110787018-110787040 TTACTAATTAATGTTCCTTGTGG + Intronic
1014511133 6:122323736-122323758 TTACTAATAAATGTCCCTTGTGG + Intergenic
1014915103 6:127137090-127137112 TTATTAATAAATGTCATTATGGG + Intronic
1016202378 6:141428665-141428687 TTTCTAATTATTTTCCTTTGTGG + Intergenic
1016747516 6:147596956-147596978 TTTCAGATAAATGTCATTTGAGG + Intronic
1017056410 6:150440373-150440395 TTACTAATAAATGTCATTTGTGG - Intergenic
1017473790 6:154767352-154767374 TTACCAGTAAGTGTTCTTTGTGG + Intronic
1017565641 6:155682675-155682697 CTACTATTACATGTGCTTTGTGG - Intergenic
1017709074 6:157149925-157149947 ATAATAATAAATTTCCCTTGAGG + Intronic
1017834139 6:158161604-158161626 TTACTAATACAAGTTGTTTGTGG - Intronic
1018746521 6:166766620-166766642 ATACTTATAAATGTCTTTTTGGG - Intronic
1018773764 6:166995626-166995648 TTCCTAATAAATATCCTCTGTGG + Intergenic
1019096700 6:169587110-169587132 TTACCAATAAATGTCCTTTGTGG + Intronic
1020193744 7:6020781-6020803 TACTTAATAGATGTCCTTTGTGG - Intronic
1021406149 7:20269292-20269314 CTGCTACCAAATGTCCTTTGAGG - Intergenic
1021644590 7:22776534-22776556 TTACTAATAAATATCCTTTGTGG - Intergenic
1021675194 7:23073603-23073625 TTATTAATTTATCTCCTTTGGGG - Intergenic
1022211246 7:28211976-28211998 TTTATAATGAATGTCTTTTGTGG + Intergenic
1022962361 7:35440235-35440257 TTTCTTATAAATCTCCATTGAGG + Intergenic
1023023299 7:36029845-36029867 TTTCCAATAAAGGTCCATTGTGG - Intergenic
1023070863 7:36431851-36431873 TTGCTAATAAATGTCCCTTGTGG + Intronic
1023464701 7:40441283-40441305 TTATTAATAAATGTCTTGGGTGG + Intronic
1023769864 7:43546896-43546918 TTACTAATAAGGGACCTTTGTGG + Intronic
1024038980 7:45534888-45534910 TTCCTCATAAAGATCCTTTGAGG + Intergenic
1024039453 7:45540279-45540301 TTTCTTAATAATGTCCTTTGTGG - Intergenic
1024528311 7:50368795-50368817 TTACTAATACAGGTCCTAAGGGG - Intronic
1024627046 7:51216721-51216743 TTACTAATGTGTTTCCTTTGTGG + Intronic
1024859141 7:53817444-53817466 TTGCTAATCAGTGTCCTTTGTGG - Intergenic
1028152834 7:87395000-87395022 TTACTAACAAATGTCCTTTGTGG - Intronic
1028164880 7:87526964-87526986 TTATTAATAAAAGTCCTTTGTGG + Intronic
1028305647 7:89260322-89260344 TTACTAATAAATGTCCTTTGTGG + Intronic
1028307606 7:89285664-89285686 TTACTAATAATTGTCCTTTGTGG - Intronic
1028908010 7:96176384-96176406 ACACTAATAAATTTCTTTTGAGG - Intronic
1031060798 7:117049236-117049258 TTCCTTACTAATGTCCTTTGTGG + Intronic
1031889413 7:127276907-127276929 TTACTAATAAATGTCTTTTGTGG - Intergenic
1032628030 7:133614161-133614183 CTCCTAATAAACATCCTTTGTGG - Intronic
1032699866 7:134370095-134370117 TTACTAACATTTGTCATTTGAGG + Intergenic
1033104735 7:138510958-138510980 TAACTATTTAATGTCCTTTATGG + Intronic
1033193492 7:139306163-139306185 ATACTCCTAAATGTGCTTTGAGG - Exonic
1033378318 7:140786823-140786845 TTGTTGATAAATTTCCTTTGTGG - Intronic
1034027206 7:147718935-147718957 TTTTTAATAACTGTCCTTTAAGG + Intronic
1034104733 7:148480636-148480658 CTACTGCTAAATGTCCTCTGGGG - Intergenic
1037439439 8:18899952-18899974 TTACTAATAAATGTCCTTTGTGG + Intronic
1038153929 8:24969205-24969227 TCATTTATATATGTCCTTTGTGG - Intergenic
1038467938 8:27783220-27783242 TTACACATATATATCCTTTGGGG + Intronic
1038881333 8:31616799-31616821 TTTCTCATAAATGTCATCTGTGG - Intergenic
1039217985 8:35294265-35294287 TTACTAATAAATGTCCTAGGTGG + Intronic
1039769408 8:40668575-40668597 TTACTAATAAGTGTCCTTAGTGG - Intronic
1039872081 8:41554628-41554650 TTACTAATAGAAGTCATTTGAGG - Intergenic
1041353377 8:56972877-56972899 TTACTAATAAATGTATTTTGTGG - Intronic
1041592659 8:59607481-59607503 TTGCTATTAAATGTGCTTTGTGG - Intergenic
1041611427 8:59854406-59854428 TTACTAATAAATGTTCTTTGTGG + Intergenic
1041614846 8:59894420-59894442 TTACTGATAAATGTTCTTTGTGG - Intergenic
1041850304 8:62383436-62383458 CTACTAATAAATGCTCTTTGTGG + Intronic
1042056931 8:64773983-64774005 TTTCTAACACATGACCTTTGGGG + Intronic
1042479685 8:69289411-69289433 TCACTTATAAATATCTTTTGAGG + Intergenic
1043352635 8:79378173-79378195 TTTCTAATTAATGTCTTTTTAGG - Intergenic
1044567721 8:93683145-93683167 TTTCTAACAAATGAACTTTGAGG - Intergenic
1044874819 8:96654911-96654933 TTACTAATAAATGTCCTTTGTGG + Intronic
1044954543 8:97465886-97465908 TTTCTGCTAAGTGTCCTTTGAGG - Intergenic
1045132896 8:99177078-99177100 TTGCTAATAAATGTCCTTGGTGG - Intronic
1045218729 8:100176024-100176046 TTACTAATAAATATCCTTTGTGG + Intronic
1045769896 8:105723811-105723833 TTACTAATAAATGTCCTTTGTGG + Intronic
1045832245 8:106476564-106476586 TCACTAATAAATGTCCTTTGTGG + Intronic
1046227095 8:111296308-111296330 TTACTATTATATCTTCTTTGTGG + Intergenic
1046270452 8:111889795-111889817 TTACTAATAAATGTACTTTGTGG + Intergenic
1047069619 8:121328939-121328961 TTACTAAAAGATGTCATTTGAGG - Intergenic
1047127501 8:121978410-121978432 GTACTAATAAAAGACTTTTGGGG + Intergenic
1047376896 8:124307888-124307910 TTACTAATAAATGTTCTTTGTGG - Intergenic
1047752126 8:127889855-127889877 ATAACAATAACTGTCCTTTGGGG - Intergenic
1047867914 8:129049208-129049230 TTACTAATAAATGTCCTTTGTGG - Intergenic
1048438669 8:134442824-134442846 TTACTAATAAATGTATTTTGTGG - Intergenic
1050224132 9:3431895-3431917 TTACTCATATGTGTTCTTTGTGG - Intronic
1051370440 9:16354873-16354895 CTAATAATAAATGTCATCTGTGG - Intergenic
1051498057 9:17747030-17747052 TTTATAATAATTCTCCTTTGTGG + Intronic
1052205344 9:25832214-25832236 TTACTAATAAATGTCCTTTGTGG + Intergenic
1052435541 9:28423447-28423469 TTATCAGTGAATGTCCTTTGTGG + Intronic
1053330742 9:37204948-37204970 TTTCTAACACATGACCTTTGGGG - Intronic
1053623193 9:39841805-39841827 ATACTAAATAATGTCCCTTGAGG + Intergenic
1053881678 9:42601423-42601445 ATACTAAATAATGTCCCTTGAGG - Intergenic
1053890991 9:42692869-42692891 ATACTAAATAATGTCCCTTGAGG + Intergenic
1054220708 9:62408890-62408912 ATACTAAATAATGTCCCTTGAGG - Intergenic
1054230006 9:62500282-62500304 ATACTAAATAATGTCCCTTGAGG + Intergenic
1055204990 9:73718543-73718565 TTAATGATAAATGTTCCTTGTGG + Intergenic
1056125840 9:83536291-83536313 CAACAAATACATGTCCTTTGGGG + Intronic
1058228851 9:102400558-102400580 TTACTAATAAATACTCTCTGTGG + Intergenic
1058339511 9:103877468-103877490 TTCCTAATAAATCTCCATTATGG - Intergenic
1058580112 9:106446661-106446683 TTACTAATAAATGTCCTTTGTGG - Intergenic
1058623451 9:106908360-106908382 TTCATAATAAATCTCCATTGTGG + Intronic
1058921763 9:109622997-109623019 TTACTAATAACTGTCTCTAGAGG - Intergenic
1059183038 9:112238049-112238071 TTAATTATGATTGTCCTTTGAGG - Intronic
1060610701 9:124961850-124961872 TAACTAATAAATGTCCTTTGTGG + Intronic
1060611060 9:124964976-124964998 TTACTAATAAATGTCTTTTGTGG + Intronic
1061186417 9:129057146-129057168 ATACTAATAAATGTCCTTTGTGG + Intronic
1062369914 9:136233035-136233057 TTCCTAATTCATGTCCTTTGTGG - Intronic
1186532254 X:10309287-10309309 TTAAAAATAAATTTACTTTGAGG - Intergenic
1186607159 X:11104320-11104342 TTTCCAAGAAATGTGCTTTGAGG - Intergenic
1187062030 X:15795771-15795793 TTCCTACTAAATGTCCTTTGTGG + Intronic
1187121535 X:16412338-16412360 CTACTAATAAATGTCCTTTGTGG - Intergenic
1188267300 X:28093439-28093461 TTACTAACACATGTAGTTTGGGG + Intergenic
1189513057 X:41682972-41682994 TTATTAATAGATGTTCTCTGTGG + Intronic
1189884751 X:45530651-45530673 TGCAAAATAAATGTCCTTTGTGG - Intergenic
1190772170 X:53524276-53524298 TTACTAATAAACGTCCTTTGTGG - Intergenic
1190781185 X:53597349-53597371 TTACTAATAAACGTCCTTTGTGG - Intronic
1191004588 X:55697603-55697625 TTACTAATAAATATCATTTGTGG + Intergenic
1191022219 X:55874277-55874299 TTACTAATAAGTGTCATTTGTGG + Intergenic
1193802108 X:85948518-85948540 TCATGAATAAATGTCCTTTGAGG - Intronic
1194086649 X:89536450-89536472 TTAATAATAAATGTTTTATGAGG + Intergenic
1194258406 X:91663500-91663522 TTAGTAATAAATATCTTTGGTGG + Intergenic
1194322516 X:92468020-92468042 TTAATAACACATTTCCTTTGTGG + Intronic
1194619822 X:96157452-96157474 TTACTAATAAATGTCCTTTGTGG - Intergenic
1194739113 X:97550958-97550980 TTAAAAATGAATGTCCTCTGTGG - Intronic
1194777510 X:97982794-97982816 ATACTATTAAATGTCCCATGGGG + Intergenic
1195506506 X:105664286-105664308 TTACCAACAAATGTTCTTTGTGG - Intronic
1195576474 X:106457401-106457423 TTAACAATGAATGTCCTTTAGGG - Intergenic
1195634090 X:107093401-107093423 TCACTAATGTATGTCCATTGTGG - Intronic
1195943172 X:110181754-110181776 TTCCTCATAGATGTCCTGTGGGG - Intronic
1196095836 X:111799087-111799109 TTACTAATAACTGTCCTTTGTGG - Intronic
1196310366 X:114156953-114156975 TTTCTAAAAAATATCCTTTAGGG - Intergenic
1196647124 X:118130022-118130044 TTAATATTAAAAGTCCTGTGTGG - Intergenic
1197167011 X:123389048-123389070 TTTCTAATTAAACTCCTTTGTGG + Intronic
1197316716 X:124975183-124975205 TTACTTCTCAATATCCTTTGTGG + Intergenic
1198021530 X:132663325-132663347 TTATTAATAAATGCACTTTCTGG + Intronic
1198456095 X:136819391-136819413 TTACTAACAAATGTCCTTTCTGG + Intergenic
1199167557 X:144695192-144695214 TTAGAAATAAATGGCCTCTGAGG + Intergenic
1199275473 X:145937131-145937153 ATACTATTAAATGTTATTTGTGG + Intergenic
1199614197 X:149642717-149642739 TCACTAATTAATGTCCTTTGTGG + Intergenic
1200360087 X:155596036-155596058 TTACTAATAAATGTCCTTCATGG - Intronic
1200439308 Y:3192324-3192346 TTAATAATAAATGTTTTATGAGG + Intergenic
1200577174 Y:4902995-4903017 TTAGTAATAAATATCTTTGGTGG + Intergenic
1200630671 Y:5581496-5581518 TTAATAACACATCTCCTTTGTGG + Intronic
1201398827 Y:13580407-13580429 TGCCTAATAAATTTCTTTTGGGG - Intergenic
1201503254 Y:14669040-14669062 TTCATGATAAATATCCTTTGAGG + Intronic