ID: 1090903316

View in Genome Browser
Species Human (GRCh38)
Location 11:131051593-131051615
Sequence TATTAGTTGTTGCAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090903311_1090903316 23 Left 1090903311 11:131051547-131051569 CCTGGCTGTGTTCTCTACTCTTG No data
Right 1090903316 11:131051593-131051615 TATTAGTTGTTGCAGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090903316 Original CRISPR TATTAGTTGTTGCAGGTGGA GGG Intergenic
No off target data available for this crispr