ID: 1090904654

View in Genome Browser
Species Human (GRCh38)
Location 11:131064634-131064656
Sequence CTGGAGGGCAGCAATTTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090904646_1090904654 12 Left 1090904646 11:131064599-131064621 CCCAAGGGTCCTGGGGTAGCTGG No data
Right 1090904654 11:131064634-131064656 CTGGAGGGCAGCAATTTTAAAGG No data
1090904648_1090904654 11 Left 1090904648 11:131064600-131064622 CCAAGGGTCCTGGGGTAGCTGGT No data
Right 1090904654 11:131064634-131064656 CTGGAGGGCAGCAATTTTAAAGG No data
1090904645_1090904654 13 Left 1090904645 11:131064598-131064620 CCCCAAGGGTCCTGGGGTAGCTG No data
Right 1090904654 11:131064634-131064656 CTGGAGGGCAGCAATTTTAAAGG No data
1090904649_1090904654 3 Left 1090904649 11:131064608-131064630 CCTGGGGTAGCTGGTGAAGCCAT No data
Right 1090904654 11:131064634-131064656 CTGGAGGGCAGCAATTTTAAAGG No data
1090904644_1090904654 17 Left 1090904644 11:131064594-131064616 CCAGCCCCAAGGGTCCTGGGGTA No data
Right 1090904654 11:131064634-131064656 CTGGAGGGCAGCAATTTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090904654 Original CRISPR CTGGAGGGCAGCAATTTTAA AGG Intergenic
No off target data available for this crispr