ID: 1090905490

View in Genome Browser
Species Human (GRCh38)
Location 11:131070938-131070960
Sequence CTTAATAAGGGGAAGGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090905490_1090905498 11 Left 1090905490 11:131070938-131070960 CCTACCTCCTTCCCCTTATTAAG No data
Right 1090905498 11:131070972-131070994 GAGCTCTGCCTCAGTTTTCCAGG No data
1090905490_1090905501 20 Left 1090905490 11:131070938-131070960 CCTACCTCCTTCCCCTTATTAAG No data
Right 1090905501 11:131070981-131071003 CTCAGTTTTCCAGGGAACCTAGG No data
1090905490_1090905502 26 Left 1090905490 11:131070938-131070960 CCTACCTCCTTCCCCTTATTAAG No data
Right 1090905502 11:131070987-131071009 TTTCCAGGGAACCTAGGCTAAGG No data
1090905490_1090905499 12 Left 1090905490 11:131070938-131070960 CCTACCTCCTTCCCCTTATTAAG No data
Right 1090905499 11:131070973-131070995 AGCTCTGCCTCAGTTTTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090905490 Original CRISPR CTTAATAAGGGGAAGGAGGT AGG (reversed) Intergenic
No off target data available for this crispr