ID: 1090910965

View in Genome Browser
Species Human (GRCh38)
Location 11:131118934-131118956
Sequence CTTTGAGAGGGCAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090910965_1090910975 18 Left 1090910965 11:131118934-131118956 CCTTCCACCTTGCCCTCTCAAAG No data
Right 1090910975 11:131118975-131118997 GAGCCCCCGCACCTGGCCTCTGG No data
1090910965_1090910972 -8 Left 1090910965 11:131118934-131118956 CCTTCCACCTTGCCCTCTCAAAG No data
Right 1090910972 11:131118949-131118971 TCTCAAAGTGCTGGGACTGCAGG 0: 14
1: 679
2: 20855
3: 315172
4: 266283
1090910965_1090910973 11 Left 1090910965 11:131118934-131118956 CCTTCCACCTTGCCCTCTCAAAG No data
Right 1090910973 11:131118968-131118990 CAGGCCTGAGCCCCCGCACCTGG 0: 5
1: 331
2: 15115
3: 78838
4: 135057

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090910965 Original CRISPR CTTTGAGAGGGCAAGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr