ID: 1090917928 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:131182695-131182717 |
| Sequence | TTAACAAGGCCCTAGGTTAC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1090917925_1090917928 | 3 | Left | 1090917925 | 11:131182669-131182691 | CCTTGGGCTTAATCAAGATCTGA | No data | ||
| Right | 1090917928 | 11:131182695-131182717 | TTAACAAGGCCCTAGGTTACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1090917928 | Original CRISPR | TTAACAAGGCCCTAGGTTAC TGG | Intergenic | ||