ID: 1090917928

View in Genome Browser
Species Human (GRCh38)
Location 11:131182695-131182717
Sequence TTAACAAGGCCCTAGGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090917925_1090917928 3 Left 1090917925 11:131182669-131182691 CCTTGGGCTTAATCAAGATCTGA No data
Right 1090917928 11:131182695-131182717 TTAACAAGGCCCTAGGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090917928 Original CRISPR TTAACAAGGCCCTAGGTTAC TGG Intergenic