ID: 1090919968

View in Genome Browser
Species Human (GRCh38)
Location 11:131198745-131198767
Sequence CTGGGCTCAGGTCATGCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090919962_1090919968 12 Left 1090919962 11:131198710-131198732 CCATTCTTTGCCAGAGTTATCTT No data
Right 1090919968 11:131198745-131198767 CTGGGCTCAGGTCATGCCTGAGG No data
1090919961_1090919968 20 Left 1090919961 11:131198702-131198724 CCAAGTTACCATTCTTTGCCAGA No data
Right 1090919968 11:131198745-131198767 CTGGGCTCAGGTCATGCCTGAGG No data
1090919964_1090919968 2 Left 1090919964 11:131198720-131198742 CCAGAGTTATCTTCTGATCAGGA No data
Right 1090919968 11:131198745-131198767 CTGGGCTCAGGTCATGCCTGAGG No data
1090919960_1090919968 23 Left 1090919960 11:131198699-131198721 CCGCCAAGTTACCATTCTTTGCC No data
Right 1090919968 11:131198745-131198767 CTGGGCTCAGGTCATGCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090919968 Original CRISPR CTGGGCTCAGGTCATGCCTG AGG Intergenic
No off target data available for this crispr