ID: 1090923561

View in Genome Browser
Species Human (GRCh38)
Location 11:131230119-131230141
Sequence AAGTAGCCTTAGGTTGCACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090923556_1090923561 18 Left 1090923556 11:131230078-131230100 CCAGACATTTGTCAAGGAAAATA No data
Right 1090923561 11:131230119-131230141 AAGTAGCCTTAGGTTGCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090923561 Original CRISPR AAGTAGCCTTAGGTTGCACT TGG Intergenic
No off target data available for this crispr