ID: 1090924027

View in Genome Browser
Species Human (GRCh38)
Location 11:131234058-131234080
Sequence GTGGTCAGAAGCAGAATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090924027_1090924036 7 Left 1090924027 11:131234058-131234080 CCTGCCATTCTGCTTCTGACCAC No data
Right 1090924036 11:131234088-131234110 ATCTCGGAGCAGGGATCTCAGGG No data
1090924027_1090924039 25 Left 1090924027 11:131234058-131234080 CCTGCCATTCTGCTTCTGACCAC No data
Right 1090924039 11:131234106-131234128 CAGGGCTGCATCCCTGAGGTGGG No data
1090924027_1090924038 24 Left 1090924027 11:131234058-131234080 CCTGCCATTCTGCTTCTGACCAC No data
Right 1090924038 11:131234105-131234127 TCAGGGCTGCATCCCTGAGGTGG No data
1090924027_1090924037 21 Left 1090924027 11:131234058-131234080 CCTGCCATTCTGCTTCTGACCAC No data
Right 1090924037 11:131234102-131234124 ATCTCAGGGCTGCATCCCTGAGG No data
1090924027_1090924031 -9 Left 1090924027 11:131234058-131234080 CCTGCCATTCTGCTTCTGACCAC No data
Right 1090924031 11:131234072-131234094 TCTGACCACAGCTGGGATCTCGG No data
1090924027_1090924034 -2 Left 1090924027 11:131234058-131234080 CCTGCCATTCTGCTTCTGACCAC No data
Right 1090924034 11:131234079-131234101 ACAGCTGGGATCTCGGAGCAGGG No data
1090924027_1090924035 6 Left 1090924027 11:131234058-131234080 CCTGCCATTCTGCTTCTGACCAC No data
Right 1090924035 11:131234087-131234109 GATCTCGGAGCAGGGATCTCAGG No data
1090924027_1090924033 -3 Left 1090924027 11:131234058-131234080 CCTGCCATTCTGCTTCTGACCAC No data
Right 1090924033 11:131234078-131234100 CACAGCTGGGATCTCGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090924027 Original CRISPR GTGGTCAGAAGCAGAATGGC AGG (reversed) Intergenic
No off target data available for this crispr