ID: 1090929556

View in Genome Browser
Species Human (GRCh38)
Location 11:131283348-131283370
Sequence CACCTCAGCCCCCAGTAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090929556_1090929563 27 Left 1090929556 11:131283348-131283370 CCAGGCTACTGGGGGCTGAGGTG No data
Right 1090929563 11:131283398-131283420 GAGCTGTCCAGGCTCCATGCAGG No data
1090929556_1090929558 -3 Left 1090929556 11:131283348-131283370 CCAGGCTACTGGGGGCTGAGGTG No data
Right 1090929558 11:131283368-131283390 GTGAGAAAGAAATAGACAGGAGG No data
1090929556_1090929559 5 Left 1090929556 11:131283348-131283370 CCAGGCTACTGGGGGCTGAGGTG No data
Right 1090929559 11:131283376-131283398 GAAATAGACAGGAGGTTCCCAGG No data
1090929556_1090929557 -6 Left 1090929556 11:131283348-131283370 CCAGGCTACTGGGGGCTGAGGTG No data
Right 1090929557 11:131283365-131283387 GAGGTGAGAAAGAAATAGACAGG No data
1090929556_1090929560 16 Left 1090929556 11:131283348-131283370 CCAGGCTACTGGGGGCTGAGGTG No data
Right 1090929560 11:131283387-131283409 GAGGTTCCCAGGAGCTGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090929556 Original CRISPR CACCTCAGCCCCCAGTAGCC TGG (reversed) Intergenic
No off target data available for this crispr