ID: 1090929559

View in Genome Browser
Species Human (GRCh38)
Location 11:131283376-131283398
Sequence GAAATAGACAGGAGGTTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090929556_1090929559 5 Left 1090929556 11:131283348-131283370 CCAGGCTACTGGGGGCTGAGGTG No data
Right 1090929559 11:131283376-131283398 GAAATAGACAGGAGGTTCCCAGG No data
1090929548_1090929559 29 Left 1090929548 11:131283324-131283346 CCAAAGAGGCCAAGAGAAAGAGC No data
Right 1090929559 11:131283376-131283398 GAAATAGACAGGAGGTTCCCAGG No data
1090929550_1090929559 20 Left 1090929550 11:131283333-131283355 CCAAGAGAAAGAGCTCCAGGCTA No data
Right 1090929559 11:131283376-131283398 GAAATAGACAGGAGGTTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090929559 Original CRISPR GAAATAGACAGGAGGTTCCC AGG Intergenic
No off target data available for this crispr