ID: 1090929560

View in Genome Browser
Species Human (GRCh38)
Location 11:131283387-131283409
Sequence GAGGTTCCCAGGAGCTGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090929556_1090929560 16 Left 1090929556 11:131283348-131283370 CCAGGCTACTGGGGGCTGAGGTG No data
Right 1090929560 11:131283387-131283409 GAGGTTCCCAGGAGCTGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090929560 Original CRISPR GAGGTTCCCAGGAGCTGTCC AGG Intergenic
No off target data available for this crispr