ID: 1090929563

View in Genome Browser
Species Human (GRCh38)
Location 11:131283398-131283420
Sequence GAGCTGTCCAGGCTCCATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090929556_1090929563 27 Left 1090929556 11:131283348-131283370 CCAGGCTACTGGGGGCTGAGGTG No data
Right 1090929563 11:131283398-131283420 GAGCTGTCCAGGCTCCATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090929563 Original CRISPR GAGCTGTCCAGGCTCCATGC AGG Intergenic
No off target data available for this crispr