ID: 1090930464

View in Genome Browser
Species Human (GRCh38)
Location 11:131293614-131293636
Sequence ATGCTTCCTAACTGGAATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090930464_1090930467 1 Left 1090930464 11:131293614-131293636 CCTGCATTCCAGTTAGGAAGCAT No data
Right 1090930467 11:131293638-131293660 GCACAGAGTATTCTTCTCTCAGG No data
1090930464_1090930468 2 Left 1090930464 11:131293614-131293636 CCTGCATTCCAGTTAGGAAGCAT No data
Right 1090930468 11:131293639-131293661 CACAGAGTATTCTTCTCTCAGGG No data
1090930464_1090930469 5 Left 1090930464 11:131293614-131293636 CCTGCATTCCAGTTAGGAAGCAT No data
Right 1090930469 11:131293642-131293664 AGAGTATTCTTCTCTCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090930464 Original CRISPR ATGCTTCCTAACTGGAATGC AGG (reversed) Intergenic
No off target data available for this crispr