ID: 1090937257

View in Genome Browser
Species Human (GRCh38)
Location 11:131354169-131354191
Sequence CAGTGTTACGGGAGAGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090937257_1090937270 23 Left 1090937257 11:131354169-131354191 CCCTCTTCTCTCCCGTAACACTG No data
Right 1090937270 11:131354215-131354237 ACTGGTGGCTTGTTCCTCCCTGG No data
1090937257_1090937271 24 Left 1090937257 11:131354169-131354191 CCCTCTTCTCTCCCGTAACACTG No data
Right 1090937271 11:131354216-131354238 CTGGTGGCTTGTTCCTCCCTGGG No data
1090937257_1090937269 8 Left 1090937257 11:131354169-131354191 CCCTCTTCTCTCCCGTAACACTG No data
Right 1090937269 11:131354200-131354222 GGAAGGAGTGGAAACACTGGTGG No data
1090937257_1090937267 -4 Left 1090937257 11:131354169-131354191 CCCTCTTCTCTCCCGTAACACTG No data
Right 1090937267 11:131354188-131354210 ACTGGGCTGAGGGGAAGGAGTGG No data
1090937257_1090937268 5 Left 1090937257 11:131354169-131354191 CCCTCTTCTCTCCCGTAACACTG No data
Right 1090937268 11:131354197-131354219 AGGGGAAGGAGTGGAAACACTGG No data
1090937257_1090937266 -9 Left 1090937257 11:131354169-131354191 CCCTCTTCTCTCCCGTAACACTG No data
Right 1090937266 11:131354183-131354205 GTAACACTGGGCTGAGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090937257 Original CRISPR CAGTGTTACGGGAGAGAAGA GGG (reversed) Intergenic
No off target data available for this crispr