ID: 1090939875

View in Genome Browser
Species Human (GRCh38)
Location 11:131377838-131377860
Sequence CATGATCACCACCACCGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 110}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090939875_1090939878 5 Left 1090939875 11:131377838-131377860 CCATCACGGTGGTGGTGATCATG 0: 1
1: 0
2: 2
3: 10
4: 110
Right 1090939878 11:131377866-131377888 GTTTTCTCATGAACAAGAACAGG 0: 1
1: 0
2: 2
3: 18
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090939875 Original CRISPR CATGATCACCACCACCGTGA TGG (reversed) Intronic
900142737 1:1145384-1145406 CATGACCCCCACCACCTTCATGG + Intergenic
902183650 1:14709115-14709137 CATCCTCACCACCACCCTAACGG + Intronic
905286703 1:36885209-36885231 CATTATCACCACTACAGTGAAGG - Intronic
905941511 1:41867033-41867055 CATCCTCACCACCACCATGATGG + Intronic
911726371 1:101245725-101245747 TATGCTCACTACCACAGTGATGG - Intergenic
913512407 1:119573802-119573824 GATGATCATCACCAGCGTCAGGG + Intergenic
917820225 1:178755280-178755302 CATGCTCACTACCAAGGTGATGG - Intronic
919035569 1:192304240-192304262 TATGATCACTACCAGGGTGACGG - Intergenic
919869422 1:201809215-201809237 CATCCTCACCACCACCCGGAGGG - Exonic
924643175 1:245852814-245852836 CGTGATCACCTGCACAGTGATGG - Intronic
924650472 1:245921881-245921903 CATGTTCACTACCAGGGTGATGG + Intronic
924689724 1:246334614-246334636 CATGCTCACTACCTCGGTGATGG + Intronic
1063667849 10:8075614-8075636 AATGAATACCACCACAGTGAAGG + Intergenic
1069622073 10:69843741-69843763 CATGACCACCATCACCGTCATGG - Intronic
1083175045 11:60944326-60944348 CATCATCACCACCATCGCCAAGG + Intronic
1083963223 11:66026012-66026034 CATGATGAGCTCCAACGTGATGG - Exonic
1085607639 11:77916756-77916778 CCTCACCACCACTACCGTGATGG + Intronic
1086534548 11:87829232-87829254 TATGATCACCACCTGGGTGATGG + Intergenic
1087844363 11:102955621-102955643 CTTCATCACCACCACTGGGAAGG + Exonic
1089447378 11:118564323-118564345 CATGATTACCAGCATCGGGATGG + Intronic
1090730116 11:129565172-129565194 CATGCTCACTATCAGCGTGATGG + Intergenic
1090939875 11:131377838-131377860 CATGATCACCACCACCGTGATGG - Intronic
1100986798 12:100209469-100209491 CATGATCATTACCACCGGGAAGG + Intronic
1105438465 13:20396816-20396838 CATCATCACTACTACCATGATGG - Intergenic
1106046113 13:26143768-26143790 CACGTTCACCACCACCCTGAAGG - Intronic
1114734670 14:25032160-25032182 CATGGTCTCCAACACCGCGAAGG + Intronic
1117740230 14:58811068-58811090 CCTCATCTCTACCACCGTGATGG - Intergenic
1123101499 14:105804970-105804992 CATGACCACCACCACCGTGGGGG + Intergenic
1125462399 15:39919882-39919904 CCAGTTCACCACCACCGTGCAGG - Exonic
1133661483 16:7922339-7922361 CATTATCACCACCACGGCTATGG - Intergenic
1139378684 16:66516689-66516711 CATGAGCACCGCCTCCGTGCCGG + Intronic
1142742013 17:1936852-1936874 CACGCTCACCACCACCGACAGGG - Exonic
1142994170 17:3751176-3751198 CATGAGCACCTCCACCTGGATGG - Intronic
1143548571 17:7614737-7614759 CTTGGTCTCCGCCACCGTGAGGG + Exonic
1147604931 17:41769193-41769215 CTTGGTCACCACCACCTGGAGGG + Exonic
1160441800 18:78898837-78898859 CATCATCATCATCACCATGATGG - Intergenic
1163352444 19:16786433-16786455 CATGCTCACTACCTCAGTGATGG - Intronic
1165365329 19:35361799-35361821 CACGATCACCCACACCCTGATGG - Intergenic
931336359 2:61347870-61347892 CACCATCACCACCACCACGATGG - Exonic
932887973 2:75564176-75564198 CCTGACCACCTCCACCCTGAAGG - Intronic
935423119 2:102891366-102891388 CATGATCACCCTCTCCCTGAAGG - Intergenic
941406103 2:165090858-165090880 CATGTTCACCACAACCAGGAAGG + Exonic
941429009 2:165389094-165389116 CATGTTCACCACAACCAGGAAGG - Exonic
941479758 2:165991935-165991957 CATGTTCACCACAACCAGGAAGG + Exonic
941495659 2:166199377-166199399 CATGTTCACCACAACCAGGAAGG + Exonic
942046154 2:172100583-172100605 CATCACCACCACCACCATCACGG - Exonic
943980041 2:194538554-194538576 CATGCTCACTACCAGAGTGATGG - Intergenic
1168880861 20:1204893-1204915 CCTCATCACCACCTCCGTGCTGG + Intronic
1174961621 20:55163925-55163947 TATGATCACCACCTGGGTGATGG - Intergenic
1175532951 20:59686471-59686493 CATGATCATCACCATCATCATGG - Intronic
1177134671 21:17296535-17296557 CAGGATCACTAGCACCGTGCAGG + Intergenic
1178505653 21:33160848-33160870 CATGACCACCACCACCATCATGG - Intergenic
1181579070 22:23816974-23816996 CATGATGACACCCACCCTGAGGG - Intronic
1182419970 22:30244290-30244312 CATCATCATCACCACCCTAAGGG + Intronic
1184697050 22:46145662-46145684 CATGGTAACCACCAGCTTGAGGG - Intergenic
1184930141 22:47674851-47674873 GATGATCACGACGACAGTGACGG - Intergenic
952998165 3:38905192-38905214 CATCCTCACCATCACCATGAAGG - Exonic
955228577 3:57079786-57079808 CATTCTCACCTCCACCGTGGAGG - Intergenic
956149734 3:66228213-66228235 ACTGATAACCACCACTGTGATGG + Intronic
963273127 3:143304861-143304883 GATGAGCACCACCACCCTTAGGG + Intronic
965363593 3:167770916-167770938 CATGATAAACAACACCATGAGGG - Intronic
965401276 3:168215632-168215654 AATGACCACCACTACCTTGAGGG + Intergenic
968187938 3:196646161-196646183 CGTGGTCACCACCAGAGTGAAGG + Intronic
974144857 4:57934549-57934571 CATGATCACCACCTTGGTGATGG - Intergenic
974880735 4:67753928-67753950 GCTGATCACCACCATCATGAAGG + Exonic
977030701 4:91878879-91878901 TATGCTCACCACCTCAGTGATGG - Intergenic
977971603 4:103219123-103219145 CCTCATCACAACCACTGTGAAGG + Intergenic
979642293 4:123023262-123023284 CATGATCACTACCTGGGTGAGGG + Intronic
983907537 4:173199605-173199627 CATGATCACCCACACCATGTAGG + Intronic
984575682 4:181445475-181445497 CATGTTAGCCATCACCGTGATGG - Intergenic
988634347 5:32966591-32966613 CATGAACAGCAGCACCGTAATGG - Intergenic
990950369 5:61292856-61292878 CCTGCTCACCACCACCCCGAGGG - Intergenic
998316240 5:141185013-141185035 CATGCTCACCACCACCAATAAGG + Exonic
1001201317 5:169719937-169719959 CATGATCACAATCACAATGATGG - Intronic
1003989719 6:11473587-11473609 CAGGGTCACCACCACCCAGAGGG + Intergenic
1004006140 6:11638786-11638808 CATGAACACCATCACAGAGATGG - Intergenic
1005774522 6:29116293-29116315 CATGATGAAAACCACTGTGAAGG - Intergenic
1006340386 6:33443436-33443458 CACCATCACCACCACCGAGGTGG + Exonic
1007426586 6:41749932-41749954 CCTGGGCACCACCACCATGAGGG - Intronic
1010955126 6:82081578-82081600 TATGCTCACCACCAGGGTGATGG + Intergenic
1013023283 6:106241932-106241954 CACTACCACCACCACCATGATGG + Intronic
1017394388 6:153979765-153979787 CATGCTCCCCACCTGCGTGATGG - Intergenic
1019353480 7:566511-566533 CATGATCATCACCATCATTATGG + Intronic
1020073430 7:5242218-5242240 CATAAACACCACCACAGGGAAGG - Intergenic
1020867423 7:13584498-13584520 CATCATTACCACCACCTTCAAGG + Intergenic
1027785715 7:82576713-82576735 CAAGATCACCACCACAAAGAGGG + Intergenic
1027814446 7:82951239-82951261 CATTTTCAGCACCACAGTGAGGG - Exonic
1030489653 7:110215608-110215630 AATGATCACCACCACGGCTAGGG - Intergenic
1032206475 7:129870203-129870225 CAGGAGCACCACCATCGAGAAGG - Intronic
1032721190 7:134551945-134551967 CATGGTGACCACCACAGTGGGGG + Intronic
1032761724 7:134949742-134949764 CATAATCACCACCATCCTGTGGG - Intronic
1033598780 7:142874623-142874645 CATGGTCACCAGCACCATGAAGG + Exonic
1037020039 8:13958889-13958911 CATGCTCCCCACCATCCTGAAGG + Intergenic
1037733362 8:21547921-21547943 CATGGTCACCACCACTGTGAAGG + Intergenic
1040284368 8:46092392-46092414 CATGACCACCACCACCCTTAGGG - Intergenic
1043077194 8:75716950-75716972 CATTATCACCACCACGTTAATGG + Intergenic
1045359524 8:101419737-101419759 CATCTTCATCACCACTGTGATGG - Intergenic
1048833563 8:138497817-138497839 AATTATCACCACCACTGTGCTGG + Intergenic
1049369385 8:142256414-142256436 CATTATCACCACCATCATCATGG + Intronic
1051876868 9:21802760-21802782 CACCACCACCACCGCCGTGAAGG + Exonic
1053543636 9:38999861-38999883 CATGATAAAAACCACAGTGATGG - Intergenic
1053808063 9:41823366-41823388 CATGATAAGAACCACAGTGATGG - Intergenic
1054622529 9:67364062-67364084 CATGATAAGAACCACAGTGATGG + Intergenic
1058167687 9:101638606-101638628 CATGATCATCATCACCATTATGG - Intronic
1058427480 9:104887413-104887435 CAAGATCACAACCTCGGTGAAGG + Intronic
1059575815 9:115487097-115487119 GATGGTTTCCACCACCGTGATGG - Intergenic
1059914155 9:119079860-119079882 CTTCATCACCACCACCATCATGG + Intergenic
1060274418 9:122171639-122171661 CATTGTCACCCCCACCGTGATGG + Intronic
1061247727 9:129409536-129409558 CATTATCACCACTATTGTGAGGG + Intergenic
1185835571 X:3343786-3343808 CAGGATCAGCACCACGGAGAGGG + Exonic
1188264371 X:28052610-28052632 TATGCTCACTACCTCCGTGATGG - Intergenic
1190326768 X:49211283-49211305 CACAACCACCACCACCGTCACGG - Intronic
1192996738 X:76520417-76520439 AGTGACCACCACCAGCGTGAGGG - Intergenic
1193103311 X:77640222-77640244 TATGTTCACTACCACGGTGATGG + Intronic
1194067036 X:89274194-89274216 CATGCTCACTACCTCAGTGATGG - Intergenic
1194895580 X:99435449-99435471 CATGATTCCCACCACTCTGAAGG - Intergenic
1195266239 X:103182925-103182947 CATTATCACTACCACCAAGAGGG + Intergenic
1198323589 X:135544058-135544080 CAAGATCACCTTCACCTTGAAGG + Intronic
1198571964 X:137967104-137967126 TATGATCACTACCTCGGTGATGG - Intergenic
1200721197 Y:6608387-6608409 CATGCTCACTACCTCAGTGATGG - Intergenic
1201241120 Y:11957233-11957255 CAGGATCAGCACCACAGAGAGGG - Intergenic
1202336875 Y:23821120-23821142 CATGGTCACAAACACCTTGAGGG + Intergenic
1202533890 Y:25848951-25848973 CATGGTCACAAACACCTTGAGGG - Intergenic