ID: 1090941140

View in Genome Browser
Species Human (GRCh38)
Location 11:131389314-131389336
Sequence CTTCCTAATGAGATGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 156}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090941132_1090941140 28 Left 1090941132 11:131389263-131389285 CCACCTCAGAGGGTGGGACCTTG 0: 1
1: 0
2: 2
3: 27
4: 232
Right 1090941140 11:131389314-131389336 CTTCCTAATGAGATGGAGCTGGG 0: 1
1: 0
2: 0
3: 12
4: 156
1090941137_1090941140 10 Left 1090941137 11:131389281-131389303 CCTTGATGCTGTGGCTGGGCAGT 0: 1
1: 0
2: 0
3: 22
4: 252
Right 1090941140 11:131389314-131389336 CTTCCTAATGAGATGGAGCTGGG 0: 1
1: 0
2: 0
3: 12
4: 156
1090941133_1090941140 25 Left 1090941133 11:131389266-131389288 CCTCAGAGGGTGGGACCTTGATG 0: 1
1: 0
2: 0
3: 7
4: 140
Right 1090941140 11:131389314-131389336 CTTCCTAATGAGATGGAGCTGGG 0: 1
1: 0
2: 0
3: 12
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090941140 Original CRISPR CTTCCTAATGAGATGGAGCT GGG Intronic
901156780 1:7145537-7145559 CTTGGGAATGAGCTGGAGCTGGG + Intronic
902973964 1:20075294-20075316 CTGGCCAAAGAGATGGAGCTGGG - Intronic
903489868 1:23720110-23720132 CTTCATAATGACCTGGGGCTAGG - Intergenic
903528906 1:24014447-24014469 TTTTTTAATGAGATGGAGCCTGG + Intergenic
904400333 1:30252562-30252584 CTTCCTAGTGAGAGAGGGCTTGG + Intergenic
905446116 1:38029505-38029527 CATCCTAATGAGCGGGAGCCGGG + Intergenic
911635910 1:100236207-100236229 CTTCCTCAGGAGATGGAGGGAGG - Intronic
912806270 1:112759168-112759190 CTTCAGAGTGAGATGGACCTGGG + Intergenic
913527472 1:119707866-119707888 CTTCCTGAAAAGGTGGAGCTTGG - Intronic
915997007 1:160573602-160573624 CTTTCTAATGAGATGATGTTGGG - Intronic
916156858 1:161859533-161859555 CTTTCTAATGAAATAGAACTTGG + Intronic
919205221 1:194413664-194413686 CTTCCTTATGAGATGGGAGTTGG - Intergenic
919755857 1:201066038-201066060 CCTCCTGATGAGTTGGAGGTGGG + Intronic
920853287 1:209643717-209643739 CTTCCTCATGGGAGGGAGCTGGG - Intronic
923815232 1:237370248-237370270 CTTCCTACTGTGAAGGAGATTGG - Intronic
1066077672 10:31896536-31896558 CTTTCTAATGATAGGGACCTGGG + Intronic
1068343072 10:55734234-55734256 CCTTCTAATGAGATGGCTCTTGG - Intergenic
1070499109 10:77053768-77053790 CTTTCTTAAGAGATGGAGGTAGG - Intronic
1070504499 10:77101177-77101199 CTTCCTGATGAGAGGGGTCTTGG - Intronic
1076282596 10:129261123-129261145 CTGACTCTTGAGATGGAGCTTGG - Intergenic
1078423304 11:11229728-11229750 CAGCCTAATGAGATGGAGCAGGG - Intergenic
1079033873 11:17006054-17006076 CTTCTTATTGAGATGTTGCTGGG - Intronic
1080091215 11:28351512-28351534 CTTCCCAATGAGGTAGAGATTGG - Intergenic
1082014366 11:47473434-47473456 ATCCTCAATGAGATGGAGCTTGG - Intronic
1082933426 11:58632559-58632581 TTCCCTGATGAGAAGGAGCTAGG + Intergenic
1085149060 11:74233481-74233503 TTTCCTAATGAGAGGCAGCAGGG + Intronic
1085237561 11:75026635-75026657 CTTCCCAGTGACATGGACCTTGG - Intergenic
1089218691 11:116852498-116852520 CTTCCTGAGGAGCAGGAGCTCGG + Intronic
1089982716 11:122785681-122785703 CTTGCTAAAGTGATGGAGCCAGG - Intronic
1090941140 11:131389314-131389336 CTTCCTAATGAGATGGAGCTGGG + Intronic
1100055661 12:90505897-90505919 TTTCCTAAAGAGATAGAGTTGGG - Intergenic
1101547300 12:105727735-105727757 ATTCCAACTGAGATGGTGCTAGG - Intergenic
1101799624 12:108009392-108009414 CATCCTAATGTGGTGGAACTTGG - Intergenic
1105575873 13:21651409-21651431 CTTATTAATAAGATGTAGCTAGG + Intergenic
1107076965 13:36332380-36332402 CCTCCCAAGGAGCTGGAGCTAGG - Intronic
1108000636 13:45902669-45902691 CTTAATACTCAGATGGAGCTGGG - Intergenic
1108856770 13:54802463-54802485 CTTCCTTGTGGGAAGGAGCTGGG + Intergenic
1112464877 13:99635201-99635223 CTTCGTAATGAAATGTACCTGGG + Intronic
1115027445 14:28761116-28761138 CTTCCTTATGGGATAGAGCTGGG + Intergenic
1116147065 14:41087843-41087865 CTTCTTAATGTGGTGGAGGTGGG + Intergenic
1120119370 14:80659394-80659416 CTTCCTGAGTACATGGAGCTTGG + Intronic
1120867036 14:89304280-89304302 CTTCCTGCTGAGCTGGAGCCCGG + Intronic
1124168723 15:27353204-27353226 GTTCCCAGTGAGATGGAGATTGG - Intronic
1125417520 15:39468808-39468830 CTTCCTGATGGAATGGAGATTGG - Intergenic
1129114285 15:73356633-73356655 CTTTTTGATGGGATGGAGCTTGG + Intronic
1129750037 15:78056338-78056360 CTTCCTAAAGAGATGGAATGGGG + Intronic
1130030721 15:80311086-80311108 ATTCCTGATGAGATTGGGCTGGG + Intergenic
1135075386 16:19389058-19389080 CTTCCTAATGAGATGAGTTTAGG + Intergenic
1136507215 16:30712367-30712389 CTTGCTGATGAGATGGGGCTTGG + Exonic
1137354437 16:47746733-47746755 CTTCCTCATAAGAGGGAGGTTGG - Intergenic
1137760988 16:50940215-50940237 CCTCCCAAGGAGAGGGAGCTGGG - Intergenic
1138597897 16:58038875-58038897 CTTCCTTGGGAGATGGAGCTTGG - Intronic
1139551250 16:67674267-67674289 CTTCCTAATGGGCTGCTGCTGGG - Intergenic
1142316541 16:89350504-89350526 CTTCCTTTTGAGATTGATCTGGG - Intronic
1143593328 17:7899134-7899156 CTAGCTGATGAGATGGGGCTAGG + Exonic
1144082451 17:11776486-11776508 CTGCCTAAAGAGAAGGAGGTTGG + Intronic
1144316124 17:14063134-14063156 CTTCCCAATGTGATGGGACTAGG + Intergenic
1144837697 17:18165765-18165787 CTTACTAAAGAGAGGGAGTTTGG - Intronic
1148076823 17:44941938-44941960 CTTCTTGCTGAGATGGTGCTGGG + Intronic
1148082617 17:44976042-44976064 CCTCCTCAGAAGATGGAGCTGGG - Intergenic
1148352234 17:46949477-46949499 CTTCCCACTGAGAGGCAGCTGGG - Intronic
1150702827 17:67462640-67462662 CATGCAAATGAGGTGGAGCTAGG + Intronic
1151182831 17:72342356-72342378 CTTCCTAATGAGCTGTCTCTGGG + Intergenic
1152929873 17:83104035-83104057 ATTCTTGATGAGAGGGAGCTGGG + Intergenic
1156080728 18:33331598-33331620 ATTTCTAATGAGATGTAGGTAGG - Intronic
1156297275 18:35804034-35804056 CATCTGAATGAGATGGAGCGAGG - Intergenic
1156881073 18:42080154-42080176 CTTCCTAAAGAAATGGTACTCGG - Intronic
1157323111 18:46649154-46649176 CTTGCTGGTGAGCTGGAGCTTGG + Intronic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1158474419 18:57767304-57767326 CTTTCTGAGGAAATGGAGCTTGG - Intronic
1160547549 18:79670403-79670425 GTTCCTGATGAAAGGGAGCTTGG - Intergenic
1165878894 19:39029082-39029104 TCTCTTAATGAGATGGAGTTGGG + Intronic
1168091875 19:54091009-54091031 CTTTTTTATGAGATGGAGCTTGG + Intergenic
927675388 2:25102046-25102068 ATTCCTAATGAGAAGGAGAAAGG - Intronic
928669876 2:33592099-33592121 CTTCTGAATGAGAAGGCGCTTGG + Exonic
929665782 2:43832719-43832741 CTTCCTAGTGACATCCAGCTAGG - Intronic
932575492 2:72960275-72960297 GTGCTTAATGAGATGGAGCCAGG - Intronic
933164517 2:79061392-79061414 TTTCCTAATGGGACTGAGCTGGG - Intergenic
944481177 2:200159478-200159500 ATTCCTTATGAGAAGGAGGTGGG - Intergenic
944868373 2:203884553-203884575 CTTTGTAATGAGATGGATCCTGG + Intergenic
948077579 2:235177628-235177650 CCTCCTTAAGAGATGGAGGTGGG - Intergenic
948601987 2:239112518-239112540 CTCTCTGATGAGATGGAGCTGGG + Intronic
948892372 2:240913804-240913826 TTTCCTAAGGAAATGGAGCCTGG + Intergenic
1169768960 20:9180786-9180808 CTTTCTAATGAGATGATTCTTGG - Intronic
1170092715 20:12608871-12608893 CCACCTAATGGGAGGGAGCTGGG - Intergenic
1170592741 20:17783308-17783330 CATCCTAAGGAGACAGAGCTCGG - Intergenic
1170750664 20:19141929-19141951 CTTCCTCATGGGCTGGGGCTGGG + Intergenic
1173044089 20:39492831-39492853 ATCCCTAATGTGATGGAGTTAGG + Intergenic
1173307672 20:41865398-41865420 CTCCCAAATGAGATGGGCCTAGG + Intergenic
1173801201 20:45895606-45895628 CTACGTAATGAAATGGGGCTGGG - Intronic
1176120464 20:63452270-63452292 CTTCTCAATGGCATGGAGCTGGG - Intronic
1176524994 21:7859386-7859408 CTTACAAATGAGATGGAGCAGGG - Intergenic
1178483110 21:32997395-32997417 CTTCCTCAGGGGTTGGAGCTTGG - Intergenic
1178659014 21:34489399-34489421 CTTACAAATGAGATGGAGCAGGG - Intergenic
1179622615 21:42627199-42627221 GTTCCTAATGAGAAGGGTCTTGG + Intergenic
1180786318 22:18549705-18549727 CTTCCTCATGAGGTGGATCAGGG + Intergenic
1181131599 22:20735431-20735453 CTTCCTCATGAGGTGGATCAGGG + Intronic
1181243239 22:21489258-21489280 CTTCCTCATGAGGTGGATCAGGG + Intergenic
1183109272 22:35637123-35637145 CTTCAACTTGAGATGGAGCTGGG - Intronic
1183732451 22:39626247-39626269 CTTCCTAACCAGATGGACATGGG - Intronic
950053250 3:10007764-10007786 GTTCCTAATGAGCTTGAGGTAGG + Intronic
951451717 3:22847349-22847371 TTTAATAATGAGATGGAGCATGG - Intergenic
952286038 3:31970641-31970663 CTTTAAAATGAGATGGAGGTGGG - Intronic
953647179 3:44766387-44766409 CTGCCTAATGAGTTGGGGCAAGG + Intronic
954446832 3:50551405-50551427 CTTCCTGATGAGCTTCAGCTGGG + Intergenic
956267120 3:67409163-67409185 TTTCCTAGTTAGATGGGGCTGGG + Intronic
957245683 3:77712836-77712858 TTTCCTAATTAGATTGAGGTTGG + Intergenic
958495003 3:94833721-94833743 CTTCCTATTCAAATGGTGCTGGG + Intergenic
962532040 3:136291459-136291481 CTTAGTAATGATAAGGAGCTGGG + Intronic
969635442 4:8366557-8366579 CTTCTCAATGAAGTGGAGCTCGG + Exonic
971473487 4:27051093-27051115 ATTGCTAATGGGGTGGAGCTGGG - Intergenic
973099659 4:46250005-46250027 CTTCCAAATGAGATGAAAATGGG - Exonic
974074727 4:57158158-57158180 CTTCCTAATGTGATGGATCCTGG + Intergenic
979080110 4:116328133-116328155 CATCCTCATGAGATAGAGTTTGG - Intergenic
979609571 4:122674816-122674838 ATTCCTAGTGAGATGGAACAAGG - Intergenic
985222453 4:187722294-187722316 CTTCCGAAGGAGATGGTGCTAGG - Intergenic
985305693 4:188536921-188536943 CTTCTGAATGAGGTGGAGCCGGG - Intergenic
986232885 5:5883308-5883330 CTTCTTTTTCAGATGGAGCTTGG - Intergenic
987492747 5:18601314-18601336 GATCCTAATCAGATGGAGGTAGG + Intergenic
988162272 5:27534148-27534170 CTTTCAAATAAAATGGAGCTTGG + Intergenic
988858846 5:35255998-35256020 CTCACAAATTAGATGGAGCTTGG + Intergenic
991297855 5:65100829-65100851 CTTCAAAAGGAGATGGAGGTGGG - Intergenic
996774932 5:127122684-127122706 GTCCCTAATCAGATGGAGGTAGG + Intergenic
999408850 5:151332160-151332182 CTTAAAAATGAGATGGAGCCGGG - Intronic
999763300 5:154719324-154719346 CTTCCAGAAGAGAGGGAGCTGGG - Intronic
1003840510 6:10114294-10114316 TTTCCTAATGACTTGGAGCAGGG - Intronic
1013154556 6:107481029-107481051 CTCCCTTCTGAGATGGAGCCTGG - Intergenic
1015919753 6:138254947-138254969 ATTCGTGTTGAGATGGAGCTAGG - Intronic
1017135029 6:151140444-151140466 CTTCCTAATAAGAGAGATCTAGG + Intergenic
1018425640 6:163677936-163677958 TTTCCTCATGAGATGGAACATGG - Intergenic
1019735593 7:2648431-2648453 CCTCCTAGTGAGCCGGAGCTGGG - Intronic
1021085771 7:16420329-16420351 CTGAGTAATGAGGTGGAGCTTGG - Intronic
1021784170 7:24135800-24135822 CTTCCCTAGGAGATGGAGCCCGG - Intergenic
1022483568 7:30760049-30760071 CTACCTTATGAAATGGGGCTGGG + Intronic
1024252421 7:47516601-47516623 CTGCTTACTGAGTTGGAGCTGGG - Intronic
1024267603 7:47618890-47618912 CTTGCTATTGAGATGGAAGTGGG + Intergenic
1024602938 7:51001113-51001135 CATCCAAAGGAGAGGGAGCTGGG - Intergenic
1027434107 7:78145922-78145944 ATTCCCAATGTGATGGTGCTTGG - Intronic
1029741576 7:102494354-102494376 CTTATCCATGAGATGGAGCTCGG + Intronic
1029759567 7:102593523-102593545 CTTATCCATGAGATGGAGCTCGG + Intronic
1029776934 7:102689433-102689455 CTTATCCATGAGATGGAGCTCGG + Intergenic
1034397300 7:150836813-150836835 CTTACTAAGGAGATGGAGCAAGG + Intronic
1034940217 7:155225787-155225809 CTACCTGCTGAGATGGTGCTGGG + Intergenic
1035434255 7:158847497-158847519 CTTCTTAAGGAGCTGCAGCTGGG + Intergenic
1038655250 8:29444897-29444919 ATCCCTAAAGAGAGGGAGCTTGG - Intergenic
1039510562 8:38088720-38088742 GGGCCTAATGAGATGGAGCCCGG + Intergenic
1040747657 8:50664735-50664757 CTTCCTAGTGAGAGGAAGATCGG + Intronic
1042144864 8:65717253-65717275 CCTTCTAATGAGTTGGACCTGGG + Intronic
1045548449 8:103149313-103149335 CTTTCTATGGAGATGGAGATTGG - Intronic
1047011384 8:120676451-120676473 CTTTGTAATCAGATGGACCTAGG - Intronic
1050211252 9:3259972-3259994 CTTCCAAATGAACTGGAGATGGG + Intronic
1050454672 9:5822328-5822350 CTAACTAATGAGAAGAAGCTGGG - Intronic
1050818421 9:9845875-9845897 CTTCCTCTGGACATGGAGCTGGG - Intronic
1051114940 9:13683831-13683853 ATTCCTAATGTGATGGTGTTTGG - Intergenic
1051624643 9:19087325-19087347 GCTCCTATTGAGATGGACCTAGG + Intronic
1052308265 9:27036121-27036143 CTTACTAATGAAATGGAAGTAGG + Intronic
1052766317 9:32644790-32644812 CTGGCAAATTAGATGGAGCTGGG + Intergenic
1056911452 9:90704641-90704663 CTTGGTCATGAGATGGAGCAGGG - Intergenic
1057516627 9:95727398-95727420 TTTCCTCATGAGATCTAGCTTGG + Intergenic
1060660819 9:125404232-125404254 CTTCCTAGGCAGCTGGAGCTGGG + Intergenic
1062384578 9:136304086-136304108 CTTCCTAATGAGCTGTCTCTTGG + Intronic
1189307010 X:39994527-39994549 CTTCCTACCAAGATGGAGGTGGG + Intergenic
1190503560 X:51102862-51102884 CTTCATAATGAGAGGGAGAATGG + Intergenic
1190525444 X:51325281-51325303 CTTCCTTCTGCGATGTAGCTTGG + Intergenic
1194091401 X:89584312-89584334 CAGCCTAAGGAGATGGAGCCCGG + Intergenic
1194951435 X:100131261-100131283 CATCCTAATGAAATAGGGCTTGG - Intergenic
1197713031 X:129685869-129685891 CTTCAGAATGAGATAGATCTTGG + Intergenic
1198081388 X:133243172-133243194 CTTTTTAAAGAGATGGAGCCAGG - Intergenic
1199694553 X:150334678-150334700 CTTCCCAATGAGCCAGAGCTTGG + Intergenic