ID: 1090941610

View in Genome Browser
Species Human (GRCh38)
Location 11:131392607-131392629
Sequence CAGGTTGAAGAGAGGGCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 801
Summary {0: 1, 1: 0, 2: 3, 3: 96, 4: 701}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090941601_1090941610 22 Left 1090941601 11:131392562-131392584 CCTCGCCTTGAGAAGGATGTGTT 0: 1
1: 0
2: 1
3: 5
4: 87
Right 1090941610 11:131392607-131392629 CAGGTTGAAGAGAGGGCAGGAGG 0: 1
1: 0
2: 3
3: 96
4: 701
1090941602_1090941610 17 Left 1090941602 11:131392567-131392589 CCTTGAGAAGGATGTGTTTTATA 0: 1
1: 0
2: 0
3: 27
4: 299
Right 1090941610 11:131392607-131392629 CAGGTTGAAGAGAGGGCAGGAGG 0: 1
1: 0
2: 3
3: 96
4: 701

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090941610 Original CRISPR CAGGTTGAAGAGAGGGCAGG AGG Intronic
900118624 1:1039261-1039283 TAGGTTGCAGGGATGGCAGGCGG + Intronic
900769951 1:4532938-4532960 CAGGCTGAGGTGGGGGCAGGGGG + Intergenic
900972093 1:5997333-5997355 GAAGGGGAAGAGAGGGCAGGAGG + Intronic
901147291 1:7074046-7074068 CTGATTGAGGAGTGGGCAGGAGG + Intronic
901784251 1:11614124-11614146 CAGCGTCAGGAGAGGGCAGGGGG - Intergenic
902249632 1:15145751-15145773 GAGGATGCAGAAAGGGCAGGAGG + Intergenic
902415756 1:16237853-16237875 CTGGTTGGAAAGAGTGCAGGTGG + Intergenic
902756063 1:18550051-18550073 CAGGAGCAAGAGAGGGGAGGAGG - Intergenic
903047499 1:20575606-20575628 CAGGTTGAAAAGGGCCCAGGGGG - Intergenic
903069722 1:20721182-20721204 GAAGGTGCAGAGAGGGCAGGAGG - Intronic
903140303 1:21335187-21335209 AAGGTTGAGGAGGGGGCAGCCGG - Intronic
903149767 1:21398423-21398445 CAGGCAGAAGAGAGAGAAGGAGG - Intergenic
903346257 1:22686001-22686023 CAGGTTTGAGAGAAGGCAGTGGG - Intergenic
903587412 1:24426748-24426770 GAGGTGGAAGAGAGGGGAGAAGG - Intronic
903725102 1:25436092-25436114 GAGGTTCAAGAGAGGCCATGAGG - Intronic
903766052 1:25735031-25735053 CAGCTTGAAGAAAGGGCTGGAGG + Intronic
904373867 1:30067175-30067197 AAGGAGGAAGAGAGGGCAGGTGG - Intergenic
904634835 1:31871881-31871903 CAGGCAGAAGGGAGAGCAGGAGG + Intergenic
904728285 1:32567197-32567219 CAGGAGGAAGAGAGTGAAGGAGG + Intronic
905171717 1:36113694-36113716 CAGGTTGAAGGCAGGAGAGGAGG + Intronic
905447134 1:38034773-38034795 CAGGGTGAAGAGAGGCAAGATGG - Intergenic
905993714 1:42362790-42362812 CAGGAGGAAGAGAGTGAAGGAGG - Intergenic
906156377 1:43616517-43616539 CAGGTTGGAGAGAGCTGAGGGGG + Intronic
906484820 1:46226160-46226182 CAGGGTGGAAAGTGGGCAGGAGG + Intergenic
907704785 1:56823344-56823366 CATGTAGAAGACAGGGCAGGTGG + Intergenic
907793383 1:57690443-57690465 CAGGAGGAAGAGAGAGAAGGGGG - Intronic
907934067 1:59026451-59026473 CAGGTAGAAGAAAGGGCAAGTGG - Intergenic
908250117 1:62259031-62259053 CAGGTGGGAGCCAGGGCAGGTGG + Intronic
908658493 1:66413366-66413388 CAGGTTGCAGAGAGAGCAAGGGG - Intergenic
908809422 1:67964650-67964672 CAGGAGGAAGAGAGAGAAGGTGG - Intergenic
909025019 1:70471297-70471319 CAGAAGGAAGAGAGGGTAGGTGG - Intergenic
909393080 1:75136998-75137020 CAGGGGGAAGGGAGGGGAGGCGG + Intronic
909700025 1:78512040-78512062 CAGGTTGAAGAGGTGTCAGAAGG - Intronic
909756060 1:79227465-79227487 TGGGTTGGAGAGGGGGCAGGGGG - Intergenic
910601321 1:89035394-89035416 CATGTTTGAGAGAGGCCAGGAGG - Intergenic
911080827 1:93928501-93928523 CAGGAGGAAGAGAGGGTAAGTGG - Intergenic
913146360 1:115993927-115993949 CAGGTGGAAGCCAGGGCAAGCGG - Intronic
913164797 1:116175158-116175180 GAGGTGGAAGTGAGGGTAGGGGG + Intergenic
913490357 1:119374149-119374171 CATGGGGAAGAGAGGGCAGGGGG - Intronic
914000214 1:143687821-143687843 GAGGTGGAAAAGGGGGCAGGTGG - Intergenic
914200556 1:145480933-145480955 GAGGTAGGGGAGAGGGCAGGGGG - Intergenic
914479670 1:148054060-148054082 GAGGTAGGGGAGAGGGCAGGGGG - Intergenic
914889685 1:151612033-151612055 CGGGGTGAAGAGGAGGCAGGGGG - Intergenic
914899968 1:151706618-151706640 CAGGTGGGAGAGGTGGCAGGAGG - Intronic
914918342 1:151831678-151831700 CAGGTGGAAGAGACTGCTGGAGG - Intronic
915224388 1:154401895-154401917 CAGGCTGATGAGAAAGCAGGAGG + Intergenic
915603813 1:156938582-156938604 CAGGAAGGAGAGAGGGCAGGAGG + Intronic
915696618 1:157749024-157749046 CTGGCTGAGGAGAGAGCAGGTGG + Intronic
915921897 1:159981984-159982006 AAGGATGAAGAGCGGGCAGAAGG - Intergenic
916304363 1:163312490-163312512 TAGGTTGAAAAGAGGGCAAAGGG + Intronic
916431691 1:164736151-164736173 CAGGGTGAAGGGAGGGGAGAGGG - Intronic
916789999 1:168116655-168116677 AAGGATGAAGGGAGGGCAGGAGG - Intronic
917269386 1:173256804-173256826 GAGGTTAAAGATAGAGCAGGAGG - Intergenic
917734438 1:177907609-177907631 CAGGTTTGAGAGAGGGGAGTGGG + Intergenic
917786089 1:178458768-178458790 CTGCTTGAAGAGAAGGAAGGGGG - Intronic
917790648 1:178496781-178496803 CAGGTTGGAGGGAGGCAAGGTGG - Intergenic
918485994 1:185028583-185028605 CAGGAGGAAGAGAGAGCAGGGGG + Intergenic
918490453 1:185075658-185075680 CAGGAGGAAGAGAGAGCAGTGGG + Intronic
919748945 1:201024719-201024741 CTGGGTGAAGTGAGGGCAGCTGG - Intergenic
922471592 1:225880423-225880445 CAGGCTGAGGAGAAGGCAGGGGG + Intronic
922656324 1:227387391-227387413 CGGGAGGAAGAGAGGGAAGGAGG + Intergenic
922717575 1:227885292-227885314 CAGGTGCAGCAGAGGGCAGGCGG + Intergenic
923223206 1:231915077-231915099 CAAGTAGAAGAGATGGCTGGAGG - Intronic
923256252 1:232223988-232224010 TGGGTTGCAGAAAGGGCAGGGGG - Intergenic
923415631 1:233757185-233757207 CAGGTTTCAGAGAGAGCAGATGG - Intergenic
923482233 1:234396456-234396478 CAGGGTGAAGAGAGGGACGGAGG - Intronic
923774445 1:236965960-236965982 CAGGTGGATGAGAGGGTGGGAGG + Intergenic
924369890 1:243336552-243336574 CAGGAGGAAGAGAGAGCAGGGGG + Intronic
1062965127 10:1601276-1601298 CAAGTGGAAGATAGGCCAGGTGG + Intronic
1063244021 10:4199946-4199968 CAGGCTGGAGAGAAGGCATGGGG - Intergenic
1063512183 10:6656211-6656233 CATCTTGGAAAGAGGGCAGGAGG + Intergenic
1063704486 10:8417694-8417716 GAGTTTGAGGAGTGGGCAGGAGG + Intergenic
1064723004 10:18248977-18248999 CAGGTAGAATTGAGTGCAGGTGG - Intronic
1065349610 10:24783652-24783674 CAGGAGGAAGAGAGAGAAGGGGG + Intergenic
1065804734 10:29384073-29384095 CAGGGTGATCAGAGAGCAGGAGG + Intergenic
1065835417 10:29653303-29653325 CAGGAGGAAGAGAGAGAAGGGGG - Intronic
1065866426 10:29919080-29919102 GAGGCAGAAGAGAGGGGAGGAGG - Intergenic
1065867433 10:29926219-29926241 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
1065874218 10:29983127-29983149 AGGGTGGAAGAGAGGGAAGGAGG + Intergenic
1065939771 10:30553775-30553797 AAGGGGGAAGAGTGGGCAGGAGG - Intergenic
1066674261 10:37872044-37872066 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
1066981778 10:42423266-42423288 GAGGTAGAGGAGAGGACAGGTGG - Intergenic
1067054446 10:43042810-43042832 CAGGCTGTGGGGAGGGCAGGAGG - Intergenic
1067081209 10:43213436-43213458 CAGGGTGAGAAGAGGGGAGGGGG + Intronic
1067546015 10:47193172-47193194 CAGGGGAAACAGAGGGCAGGAGG + Intergenic
1068435730 10:56989006-56989028 GAGGTGGAAGAGAAGGAAGGAGG + Intergenic
1068559233 10:58494533-58494555 CAGGAAGAAGAGAGAGAAGGGGG + Intergenic
1068580041 10:58729719-58729741 CAGGATGAAGAGAGTGAAAGAGG + Intronic
1068936355 10:62639061-62639083 CAGGTTGAGGAGGGGTGAGGAGG + Intronic
1069690928 10:70351521-70351543 CATGCAGAAGAGAGGGCAGCAGG - Intronic
1070490321 10:76969899-76969921 CAGGGTGAGGAGAGGGCGAGGGG + Intronic
1071681379 10:87709246-87709268 CAGGAATAAGAGAGGGCAAGTGG + Exonic
1072428095 10:95347412-95347434 CAGATAGAGGAGAGGGTAGGAGG - Intronic
1072563344 10:96597139-96597161 CAGGCTGAAGAGATAGAAGGAGG - Intronic
1072635822 10:97177175-97177197 CAGGTTGGAGAGAGAGATGGGGG - Intronic
1073102188 10:101012137-101012159 GAGGTTGCAGAGAGGGCTTGGGG - Intronic
1073877194 10:107938547-107938569 CAGGGAGAAGGGAGGGAAGGGGG - Intergenic
1073979687 10:109140886-109140908 CAGGATGAAGAGAGGGAGGTGGG + Intergenic
1074366548 10:112862081-112862103 GAGGTTGCAGAGAGAGGAGGTGG + Intergenic
1074543208 10:114383373-114383395 AAGGGTGAAGGGAGGGAAGGAGG + Intronic
1074721606 10:116270559-116270581 CAGGTTTCAGAGAGGTCAGCGGG + Intronic
1075518199 10:123126484-123126506 AAGGCTGGACAGAGGGCAGGAGG - Intergenic
1075596846 10:123738081-123738103 CAGGAGAAAGAGAGGGCAGGGGG - Intronic
1076040468 10:127243515-127243537 CAGGTAGAAGGAAGGGCAGGTGG - Intronic
1076312494 10:129518475-129518497 CAGGGGGAAGGGAGGGGAGGAGG - Intronic
1076312507 10:129518500-129518522 CAGGGGGAAGGGAGGGGAGGAGG - Intronic
1076464120 10:130666679-130666701 CAGGCTGAAAAGAGGGAAAGAGG + Intergenic
1076538225 10:131196606-131196628 GACGTAGAGGAGAGGGCAGGAGG + Intronic
1076790678 10:132775196-132775218 CAGGGAGGAGAGGGGGCAGGGGG + Intronic
1077015952 11:399312-399334 CAGGTGGCAGAGGGGGCAGGTGG - Intronic
1077015988 11:399400-399422 CAGGTGGAGGAGGGGGCAGGTGG - Intronic
1077338349 11:2015323-2015345 GAGGTTAAACAGAGGGCAGCCGG + Intergenic
1077548069 11:3185083-3185105 CAGGAGGAAGAGAGGCCAGAGGG + Intergenic
1078944380 11:16047068-16047090 GGGGTTGAGGAGTGGGCAGGAGG + Intronic
1080079093 11:28193390-28193412 CAGGAGGAAGAGAGAGAAGGTGG + Intronic
1081296553 11:41397250-41397272 GAGGTGGAAGAGGAGGCAGGAGG - Intronic
1081441345 11:43084952-43084974 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
1081441622 11:43086960-43086982 CAGGAGGAAGAGAGTGGAGGGGG + Intergenic
1081997933 11:47376868-47376890 GAGCTTGCAGAGAGGGCTGGGGG + Intronic
1083257816 11:61507489-61507511 CGGGTTCAAGAGAAGGCAGGAGG + Intergenic
1083697654 11:64453463-64453485 CAGGTAAAGGAGGGGGCAGGAGG + Intergenic
1083735186 11:64676122-64676144 CAGCGGGCAGAGAGGGCAGGGGG + Intronic
1083966418 11:66046589-66046611 CAGGAGTAAGAGAGGGGAGGAGG + Intronic
1084020301 11:66413362-66413384 CAGCTGGAAGAGAGGCAAGGGGG + Intergenic
1084045355 11:66564852-66564874 CAGGGTGAGGTGAGGTCAGGTGG - Intronic
1084092707 11:66889141-66889163 CAGGGTGAAGGGAGGGAAAGTGG + Intronic
1084209516 11:67614576-67614598 GAGGTGGAAGAGAGGACAGATGG - Intergenic
1084406203 11:68975053-68975075 CAGATTGAAGACAGGGAAGAGGG + Intergenic
1084470413 11:69356174-69356196 GAGGATGAAGAGAAGGAAGGAGG + Intronic
1084568351 11:69944295-69944317 CAGGGTGCGGACAGGGCAGGAGG + Intergenic
1084793362 11:71489044-71489066 AAGGTTCCAGAGAGAGCAGGAGG + Intronic
1085032997 11:73283919-73283941 GGTGCTGAAGAGAGGGCAGGAGG + Intronic
1085849519 11:80103440-80103462 AAGGTTGAAGAAAAGGAAGGGGG - Intergenic
1085862858 11:80255148-80255170 CAGGTTGATCAGAGGAAAGGTGG + Intergenic
1086102330 11:83114111-83114133 GAGGCTGAAGCGAGGGCAGATGG - Intergenic
1086794749 11:91085581-91085603 CAGGAGGAAGAGAGAGAAGGGGG - Intergenic
1087007438 11:93483503-93483525 CAGGTGGGAGAGAGGCCTGGGGG + Intronic
1087713920 11:101584756-101584778 CAGGTTGATGTGATGGCAGCTGG + Intronic
1088811917 11:113397891-113397913 AAGGTTGGAGAGAGGGAAGGAGG + Intronic
1088946610 11:114519633-114519655 CAGGTGGAAGGAGGGGCAGGAGG + Intergenic
1089129106 11:116198641-116198663 AAGGTTGGAGAAAGGGCAGCAGG + Intergenic
1089176439 11:116552180-116552202 CAGGGTGAAGAGGGTGCAGGTGG - Intergenic
1089188992 11:116640853-116640875 CTGGTTGGAGGGAGGCCAGGAGG - Intergenic
1089345099 11:117786002-117786024 CAGCTTGGAGAGAAGGCATGAGG - Intronic
1089356456 11:117857077-117857099 CAGGGACATGAGAGGGCAGGAGG + Intronic
1089834441 11:121357637-121357659 CAGGTGGTCGGGAGGGCAGGTGG + Intergenic
1089916476 11:122161780-122161802 AAGGTTGGAGGGAGGGGAGGTGG - Intergenic
1090334717 11:125954726-125954748 CAGGATGGAGAGGGGGCAGCAGG - Intergenic
1090446110 11:126766191-126766213 CAAGGAGAAGAGAGGGGAGGAGG - Intronic
1090593274 11:128294180-128294202 CAGGATGAAGACAGAGCAAGGGG - Intergenic
1090640594 11:128726200-128726222 CAGCTTCAGGGGAGGGCAGGGGG - Intronic
1090687058 11:129133132-129133154 CAGGGGGAAGAGTGAGCAGGAGG + Intronic
1090805650 11:130200442-130200464 CAGGAGCAAGAGAGAGCAGGAGG + Intronic
1090924936 11:131241236-131241258 CAGCCTGAAGAGAGGACTGGGGG - Intergenic
1090941610 11:131392607-131392629 CAGGTTGAAGAGAGGGCAGGAGG + Intronic
1090960303 11:131550510-131550532 CAGGAGGAAGAGAGAGAAGGAGG - Intronic
1091254519 11:134172174-134172196 CAGGTAGCAGAGAGCGCAAGAGG - Intronic
1091310998 11:134575120-134575142 CAGGTGGTAGAAAGGGCACGAGG - Intergenic
1202821333 11_KI270721v1_random:70505-70527 GAGGTTAAACAGAGGGCAGCCGG + Intergenic
1091675140 12:2483811-2483833 CAGGCTGGAGAGAGGCCAAGTGG - Intronic
1093425036 12:19019163-19019185 CAGGAGGAAGAGAGAGAAGGGGG + Intergenic
1093718882 12:22414787-22414809 CAGGAGGAAGAGAGGGAAGGGGG + Intronic
1094464944 12:30743123-30743145 CAGGTAGAAGCGGGGGCGGGGGG - Intronic
1095107285 12:38249842-38249864 CAGGTGGCAGTGAGGGCAGCAGG + Intergenic
1095930183 12:47617830-47617852 CAGGTTGGGGAGAGGGTAAGAGG - Intergenic
1097475312 12:60047913-60047935 CAGGAGGAAGAGAGTGAAGGAGG - Intergenic
1097606565 12:61761980-61762002 CAGGAGGAAGAGAGAGCAAGAGG - Intronic
1097639414 12:62161543-62161565 CAGAATGGTGAGAGGGCAGGAGG + Intronic
1097750374 12:63345942-63345964 CAGGAGGGAGAGAGAGCAGGGGG + Intergenic
1098961224 12:76741259-76741281 CTGGTAGAAGAGAGGGCCGTTGG + Intergenic
1099618575 12:84972606-84972628 CTGGATGAAGAGAGGCCAAGGGG - Intergenic
1099724903 12:86412974-86412996 CAGGAGGAAGAGAGTGAAGGGGG - Intronic
1099726323 12:86432502-86432524 CAAGTAGAAGAGATGGAAGGTGG + Intronic
1099847367 12:88044781-88044803 CAGGAAGAGGAGAGGGCATGGGG + Intronic
1099868986 12:88322342-88322364 CAGGAGGAAGAGAGAGCATGGGG + Intergenic
1099927647 12:89037758-89037780 CAGGGTGAAGAGGTGGGAGGCGG - Intergenic
1099988650 12:89699070-89699092 CATGGTGAAGAGGGGACAGGGGG - Intronic
1100909841 12:99346793-99346815 CAGGAGGAAGAGAGAGAAGGGGG - Intronic
1101059278 12:100954275-100954297 CAGGCTGAAGTGATGGGAGGTGG - Intronic
1101204784 12:102475758-102475780 CAGGTAGAAGAGATGCGAGGAGG + Exonic
1101429307 12:104613571-104613593 CAGGAGGAAGAGAGAGAAGGGGG - Intronic
1101629830 12:106482496-106482518 CAGGAGGAAGAGAGAGAAGGGGG + Intronic
1101843099 12:108341931-108341953 CAAGTAGAGGAGAGGGGAGGGGG + Intergenic
1102039901 12:109794128-109794150 CAGGAGGAAGAGAGTGAAGGAGG - Intronic
1102209697 12:111117075-111117097 TAGGTTGAAAAGAGGGTAAGAGG + Intronic
1104133871 12:125919406-125919428 CAGTTTGGAGAAAGGGCGGGGGG - Intergenic
1104479920 12:129098884-129098906 GAGGATTAAGAGAGGGTAGGAGG - Intronic
1104547765 12:129727585-129727607 CAGGTCAGAGAGAGGGCAAGAGG + Intronic
1104581149 12:130011724-130011746 CAGGAGGAAGAGAGAGCAGGAGG + Intergenic
1104648603 12:130514643-130514665 CAGGCTGACGACAGGGCTGGTGG - Intronic
1104714236 12:131005953-131005975 CAGGCTGCAGAGAGAGCAGAGGG - Exonic
1104860981 12:131923374-131923396 CAGGGTGAAGAGAGTCCAGAGGG + Intergenic
1106033325 13:26021978-26022000 CAGGATGCAGAGAGGGCCTGAGG + Exonic
1106458953 13:29951578-29951600 CAGGAGGAAGAGAGCGAAGGGGG + Intergenic
1106583346 13:31036384-31036406 GAGGAGGAAGAGAGGGCAGTGGG - Intergenic
1106942491 13:34793630-34793652 CAGGATCAAGAGAGGGGATGGGG + Intergenic
1107061374 13:36163055-36163077 TAGGCTGCAGAGAGGGAAGGTGG + Intergenic
1107337664 13:39372952-39372974 TAGGTTGCAGAGAGGGCAGGAGG - Intronic
1107401974 13:40077970-40077992 CAGGTAGAAGAGAGGGAGGCAGG + Intergenic
1107420328 13:40240107-40240129 CAGTGTGGAGGGAGGGCAGGGGG - Intergenic
1107634756 13:42381001-42381023 CAGGGTGCACAGAGGGGAGGGGG + Intergenic
1107677619 13:42813134-42813156 CAGGAGGAATAGAGAGCAGGAGG - Intergenic
1108054806 13:46474902-46474924 GAGGTTAAGGAGGGGGCAGGAGG + Intergenic
1108141650 13:47428922-47428944 CAGGCTGAAGAGCAGGAAGGAGG + Intergenic
1109391100 13:61694851-61694873 CAGGAGGAAGAGAGAGGAGGGGG - Intergenic
1109688354 13:65850414-65850436 TTGGTTGACGAGAGGTCAGGTGG + Intergenic
1109999126 13:70171219-70171241 CAGTTTGAAGAGTTGGCTGGTGG + Intergenic
1110404046 13:75128729-75128751 CAGGTCTAAGGGAGGGGAGGTGG + Intergenic
1110892910 13:80712783-80712805 CAGGAGGAAGAGAGTGAAGGTGG + Intergenic
1111571408 13:90091787-90091809 CAGGAGGAAGAGAGTGAAGGAGG + Intergenic
1111887595 13:94042158-94042180 TAGGAGGAAGAGAGGGAAGGGGG - Intronic
1111918941 13:94390535-94390557 CAGGAGGAAGAGAGGGAAGGGGG + Intronic
1112028531 13:95435755-95435777 CAGGTAGAAGAGATGGCATATGG + Intronic
1113134553 13:107075130-107075152 CAGGAGGAAGAGAGAGAAGGGGG + Intergenic
1113149781 13:107250876-107250898 CAGGAGGAAGAGAGTGAAGGGGG - Intronic
1113606143 13:111608386-111608408 CAGGAGGAAGAGAGTGAAGGGGG + Intronic
1113896326 13:113766542-113766564 CAGGGTGACCAGAGGGCAGGAGG + Intronic
1115243562 14:31272680-31272702 CAGGTGGCAAAGAGGGAAGGAGG - Intergenic
1116007149 14:39306413-39306435 CAGGAGGAAGAGAGTGAAGGGGG + Intronic
1116107022 14:40521968-40521990 CAGGAGGAAGAGAGAGCAAGGGG + Intergenic
1116369998 14:44118083-44118105 CATTTTGATGAGAGAGCAGGTGG - Intergenic
1116442703 14:44972008-44972030 AAGGAGGAAGAGAGGGCAGGAGG + Intronic
1116662864 14:47734447-47734469 CAGGAGGAAGAGAGTGAAGGAGG + Intergenic
1117268192 14:54113092-54113114 CAGGAGGAAGAGAGGAAAGGGGG - Intergenic
1117343670 14:54812624-54812646 CAGGATGAAGGAAGGGAAGGAGG - Intergenic
1117588384 14:57238465-57238487 TAGGATGAAGACAGGGTAGGGGG + Intronic
1117888268 14:60388557-60388579 CAGGAGCAAGAGAGGGCAGGAGG - Intergenic
1118487389 14:66226711-66226733 AAGGAGGAAGAGAGAGCAGGTGG + Intergenic
1119184777 14:72632632-72632654 CAGGAGGAAGGGAGGGAAGGAGG + Intronic
1119552667 14:75526224-75526246 CAGAGTGAAGAGAGGTAAGGTGG - Intronic
1119763915 14:77175998-77176020 CAGGGGTAAGAGAGGGCAGAGGG + Intronic
1120033840 14:79673123-79673145 CAGGCTGAAGAGAGGGGAAAGGG + Intronic
1120163472 14:81170007-81170029 CAGGTTGCAGGGAGCCCAGGGGG + Intergenic
1121104184 14:91270131-91270153 GAGGAGGAAGAGAGGGAAGGAGG - Intergenic
1121106769 14:91285353-91285375 CAGGTGCAAGAGACGGGAGGGGG + Intronic
1121492271 14:94369089-94369111 CAGGTAGGAGAGAGGGAAGAGGG + Intergenic
1122781228 14:104144407-104144429 CAGGTAGAGGACAGGGAAGGAGG + Intronic
1123069673 14:105636328-105636350 CAGGCTGAAGAGAGGGGCAGAGG - Intergenic
1123094697 14:105761368-105761390 CAGGCTGAAGAGAGGGGCAGAGG - Intergenic
1124435607 15:29646533-29646555 CAGGTAGAAGAGAAGGCAGAAGG - Intergenic
1124445111 15:29723388-29723410 CAGGAGGAAGAGAGAGAAGGGGG - Intronic
1125281587 15:38047549-38047571 CAGGAGGAAAAGAGGGAAGGGGG + Intergenic
1125896508 15:43307290-43307312 GAGTTTGAAGAGGGGGCAGAAGG - Intergenic
1126497426 15:49307442-49307464 CAGGTTGATTAGAGGGGAGAGGG + Intronic
1126907542 15:53384197-53384219 GAGGTTGAAGAGAGGAAAGAAGG - Intergenic
1127116985 15:55738764-55738786 CAGGAAGAAGAGAGGGAGGGAGG + Intronic
1128276229 15:66356285-66356307 GAAGTTGAAGAGAGGGTAGGCGG - Intronic
1128449906 15:67799453-67799475 CGGGAGGAAGAGAGAGCAGGTGG + Intronic
1129182931 15:73888282-73888304 CAGGCTGGGGAGAGGTCAGGTGG + Intronic
1129675815 15:77632104-77632126 GGGGTTGGAGAGAGGGGAGGTGG + Intronic
1129715519 15:77846342-77846364 CAGGAGGAAGAGAGAGAAGGAGG - Intergenic
1129743317 15:78000837-78000859 TAGATTGAAGAGAGGGAGGGAGG - Intronic
1130717676 15:86351788-86351810 CAGCTTGTAGAGAAGGCAGAAGG - Intronic
1130938797 15:88491080-88491102 CAAGGTGCAGAGAAGGCAGGTGG - Intergenic
1131121198 15:89824271-89824293 GAGGTTGTGGTGAGGGCAGGGGG - Intergenic
1131770058 15:95727506-95727528 CAGGAGGAAGAGAGGGAAGGGGG + Intergenic
1132349597 15:101131351-101131373 CAGGAGGAAGAGAGTGAAGGGGG - Intergenic
1132373104 15:101311425-101311447 CAGGAGCAAGAGAGGGAAGGAGG - Intronic
1132405853 15:101541555-101541577 CAGGTGGAAGAGGGGACAGGAGG - Intergenic
1132650801 16:1020708-1020730 GAGGGTGGAGGGAGGGCAGGCGG + Intergenic
1132726117 16:1339060-1339082 GAGGTGGGAGCGAGGGCAGGAGG - Intronic
1133208613 16:4249619-4249641 CTGGTTCAAGAAAGGACAGGAGG + Intergenic
1133237131 16:4392597-4392619 GAGGTTGGATGGAGGGCAGGCGG + Intronic
1133460127 16:5980296-5980318 CAGCTTGCAGAGAGAGCAGGGGG + Intergenic
1134171818 16:11975529-11975551 CAGGGTGGAGAAAGAGCAGGTGG - Intronic
1134321411 16:13167672-13167694 CAGGAGGAAGAGAGAGAAGGGGG - Intronic
1135055594 16:19229401-19229423 CAGGAGGAAGAGAGTGAAGGGGG + Intronic
1135060926 16:19270764-19270786 CAGGTTGAAGTGAGGTCATGAGG + Intergenic
1135138416 16:19901690-19901712 CAAGATGAAGAGAGGTCATGAGG + Intergenic
1135533523 16:23274974-23274996 CTGGTTGAGGAAAGGGTAGGTGG + Intergenic
1135672076 16:24384029-24384051 CAGCTTGAGGACAGGGCATGTGG - Intergenic
1135681980 16:24465253-24465275 CAGGAAGAAGAGAGAGAAGGGGG + Intergenic
1138352425 16:56353095-56353117 CAGGATGGAGTGAGGGCAGGAGG + Intronic
1138749243 16:59398817-59398839 GTGGTGGAAGAGAGGGCAGGTGG - Intergenic
1139513435 16:67440102-67440124 AAGGTGGCAGAGAGGGCCGGGGG - Intronic
1140693429 16:77507530-77507552 CAGGGTGGAGGGAGAGCAGGGGG + Intergenic
1140798633 16:78464348-78464370 AAGGAGGAAGAGAGGGAAGGAGG + Intronic
1141675236 16:85514182-85514204 GAGGAGGAAGAGAGGGGAGGGGG - Intergenic
1141788776 16:86218815-86218837 CAGGTTGAGGGAATGGCAGGAGG - Intergenic
1142280702 16:89146209-89146231 CAGGTAGAGACGAGGGCAGGGGG + Intronic
1142328876 16:89437560-89437582 CAGGTTGGAGAGAGCTCTGGAGG - Intronic
1142501412 17:335262-335284 CAGGGTGAACAGTGGGAAGGAGG + Intronic
1142708091 17:1709093-1709115 CAAAATGAAGAGAGGGCCGGGGG + Intronic
1142785763 17:2221343-2221365 CAGGAGGAAGAGAGTGAAGGGGG - Intronic
1142820486 17:2462628-2462650 GAGGAGGAAGAGAGGGAAGGAGG - Intronic
1143002362 17:3802649-3802671 CAGAATGAAGTGAGGGGAGGAGG - Intergenic
1143040679 17:4033967-4033989 AAGGTGGGATAGAGGGCAGGTGG + Intronic
1143448333 17:7021719-7021741 GAGGAGGGAGAGAGGGCAGGAGG - Intergenic
1144358410 17:14468167-14468189 CAGGAGGAAGAGAGAGAAGGGGG + Intergenic
1144397120 17:14855169-14855191 CAGGTAGATGAGAGGAGAGGAGG - Intergenic
1144750878 17:17647236-17647258 AAGATTGAAGAGAGGGGACGTGG + Intergenic
1145901763 17:28494521-28494543 CAGGCTGAGGAGGGGGCTGGGGG - Intronic
1146400602 17:32497580-32497602 CAGGGACAACAGAGGGCAGGAGG - Intronic
1146442479 17:32909257-32909279 CAAGTTGAAGAGAGAACGGGAGG + Intergenic
1146734900 17:35230356-35230378 CAGGATGAATAGAGGGAAGGGGG + Intergenic
1147660117 17:42112883-42112905 CAGGTTAAGGTGAAGGCAGGAGG + Intergenic
1147765708 17:42834107-42834129 CAGGAGGAAGGGAGGGAAGGGGG + Intronic
1148128892 17:45250864-45250886 CAGGAAGGAGAGAGGGCAGAGGG + Intergenic
1148447008 17:47743975-47743997 GAGGTAGAAGAGGGGGCAAGAGG + Intronic
1148520555 17:48270934-48270956 CAGGTTTAAGCGGGGGGAGGGGG + Intronic
1148997475 17:51723801-51723823 CAGATGGAAAAGAGGGCAGAGGG - Intronic
1149637218 17:58180747-58180769 CAGGGTGCAGGGAGGGAAGGGGG - Intergenic
1149718597 17:58819700-58819722 CAAGTAAGAGAGAGGGCAGGAGG + Intronic
1150469834 17:65427515-65427537 CAGGTTTAAGGGAGGGGATGTGG + Intergenic
1150862139 17:68811640-68811662 CAGGAGGAAGAGAGAGCAGGAGG - Intergenic
1152302446 17:79503173-79503195 CAGGGTCAAGTGAGGTCAGGAGG - Intronic
1153836620 18:8969751-8969773 AAGGTGGAAGGGAGGGAAGGGGG - Intergenic
1155071774 18:22323149-22323171 CAGGAGGAGGAGAGGGCTGGGGG + Intergenic
1155113539 18:22739951-22739973 CAGGAGGAAGAGAGAGAAGGGGG - Intergenic
1155396041 18:25387741-25387763 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
1156674364 18:39509844-39509866 GAGGAAGAAGAGAGGGGAGGAGG - Intergenic
1157294523 18:46433226-46433248 CAGGTGGAAGTGGCGGCAGGAGG - Exonic
1157475388 18:48020696-48020718 CGGGTTGAAGAGAGGAGAGGAGG - Intergenic
1157727777 18:49978163-49978185 CAGGTGGTAAAGGGGGCAGGAGG - Intronic
1158861191 18:61593907-61593929 CAGGTTGAAGGGAGAGCAAGAGG - Intergenic
1158887094 18:61838882-61838904 AAGGAGGATGAGAGGGCAGGTGG - Intronic
1158962975 18:62601666-62601688 CAGGGCGAGGAGAGGGCAGCTGG + Intergenic
1159677487 18:71303968-71303990 CAGGAGGAAGAGGGAGCAGGGGG - Intergenic
1159777722 18:72623082-72623104 CAGGAGGAAGAGAGCGAAGGGGG + Intronic
1160145442 18:76360040-76360062 CAGGGTGCACAGAGTGCAGGAGG - Exonic
1160208642 18:76858627-76858649 CAGGTGGAGGCGAGTGCAGGTGG + Intronic
1160754495 19:750600-750622 CAGGGCTAAGAGAGGTCAGGTGG + Intergenic
1160876436 19:1298531-1298553 CAGCTAGAAGAGAGGGGATGGGG - Exonic
1161607081 19:5221092-5221114 CAGGTTGAAGGCAGTCCAGGCGG + Exonic
1161680220 19:5676418-5676440 GAGCTAGAAGAGAGAGCAGGGGG - Intronic
1162187927 19:8921843-8921865 CAGGGGGAAGAGGGGACAGGGGG - Intronic
1162497399 19:11030913-11030935 CAGGTCGAGGAGAAGGAAGGGGG + Intronic
1162567305 19:11451577-11451599 CAGGATGAAGGGAGGGGTGGAGG + Exonic
1162588929 19:11578325-11578347 TGGGATGGAGAGAGGGCAGGGGG - Intronic
1162924993 19:13926431-13926453 CTGGGGGAAGAGAAGGCAGGCGG + Intronic
1163054632 19:14709095-14709117 CAGGAGGAAGAGAGTGAAGGGGG - Intronic
1163531061 19:17849155-17849177 CAGCTTGAAGAGCAGTCAGGAGG + Intergenic
1163675655 19:18654119-18654141 TAGATGGAAGAGTGGGCAGGTGG - Intronic
1164727317 19:30474926-30474948 CAGGTAGGAGAGAGGAAAGGGGG - Intronic
1165241518 19:34472156-34472178 CAGGGTGAGGACAGGGCACGCGG - Intergenic
1165600979 19:37055799-37055821 CAGGATGAAGAAACAGCAGGCGG + Intronic
1165722210 19:38087658-38087680 CAGGTAGACGAGGGAGCAGGAGG + Intronic
1165768989 19:38367586-38367608 CAGCTTGCAGCTAGGGCAGGTGG + Intronic
1166072434 19:40395011-40395033 CAGGAGGAAGGGAGGGCAGAGGG - Exonic
1166092442 19:40519035-40519057 CTGGTTTAAGAGATGGCAGCTGG + Intronic
1166197704 19:41217881-41217903 CAGGTAGAAGAGACATCAGGAGG + Intergenic
1166550388 19:43662087-43662109 CAGGTGGAGAAGAGGGCAGCAGG - Intronic
1166560287 19:43728314-43728336 CAGGAGCAAGAGGGGGCAGGTGG - Exonic
1166852257 19:45766534-45766556 CAGGTTCAATAGTGGGGAGGTGG + Exonic
1167116698 19:47492796-47492818 CAGGCTGAAGACAGGGTGGGGGG + Intronic
1167529172 19:50004281-50004303 CAGGGTGGGGAGAGGGCAGGAGG - Intronic
1167572574 19:50298280-50298302 CAGGTGAAAGAGGGGGCAGGAGG + Intronic
1167660145 19:50791627-50791649 CGGGGTGGAGAGAGGGCACGCGG - Intronic
1168130619 19:54316277-54316299 CAAGTTGGAGAGAGGACAGATGG - Intergenic
1168282640 19:55313614-55313636 AAGGATGAAGAGAGGGCCGGGGG - Intronic
1202647180 1_KI270706v1_random:153102-153124 CAGGTGGAGGAGTGGTCAGGAGG - Intergenic
925085113 2:1101595-1101617 CAGGATGAAGGGAGTGCAGGAGG + Intronic
925303748 2:2835070-2835092 CAGGCAGAAGGGAGGGCAGCTGG - Intergenic
925591236 2:5512182-5512204 AGGATTGAAGAGTGGGCAGGAGG - Intergenic
925929855 2:8698287-8698309 CAGGAGGAAGAGAGCGAAGGGGG - Intergenic
926055887 2:9773728-9773750 AAGTCTGAAGAGAGGGGAGGCGG - Intergenic
926143441 2:10382496-10382518 CTGGTAGTAGGGAGGGCAGGAGG + Intronic
926418521 2:12674688-12674710 CTAATTGAAAAGAGGGCAGGTGG - Intergenic
926688799 2:15718551-15718573 CAGGATGAAGGGAGGCCAGCAGG - Intronic
927595330 2:24391807-24391829 GAGTATGAAGAGAGGGAAGGAGG - Intergenic
927863747 2:26576114-26576136 CAGGTTGAAGCGAGTGTAGCTGG - Exonic
928169470 2:28994137-28994159 GAGGCTGAAGGGAGGGCTGGAGG + Intronic
929672368 2:43886901-43886923 GAGGCTGAAGCGAGCGCAGGGGG + Exonic
929782800 2:44968155-44968177 GAGTTTGGAGAGAGGGTAGGTGG + Intergenic
929792530 2:45034210-45034232 CAAGGTGAAGAGAGGGCTGCAGG + Intergenic
930365435 2:50433731-50433753 AAGGTGGAAGGGAGGGAAGGAGG + Intronic
930705856 2:54504177-54504199 CAGGTTGGAAGGAGGGGAGGTGG - Intronic
931954992 2:67413025-67413047 GAGGTCTAAGAGAAGGCAGGAGG - Intergenic
932465490 2:71921045-71921067 AAGGAGGAAGAGAGAGCAGGGGG - Intergenic
932575480 2:72960246-72960268 CAGGTTCGAGGGAGGGCAGTGGG - Intronic
932727244 2:74189940-74189962 CTGGTTGAAGACAGGGCATTTGG - Intergenic
933180633 2:79222650-79222672 CAGGAAGAAAAGAAGGCAGGAGG - Intronic
933253489 2:80054907-80054929 TAGGGTGAAGAGAGTGGAGGGGG + Intronic
933267684 2:80199920-80199942 CAGGGAGAGCAGAGGGCAGGAGG + Intronic
934751918 2:96799281-96799303 CAGGTGGGAGAGAGGGCCTGGGG - Intronic
934781286 2:96971276-96971298 GAGGTGGGAGAGAGGGAAGGAGG - Intronic
935092096 2:99905072-99905094 GAGGTGGTAGAGAGAGCAGGAGG - Intronic
935325071 2:101928411-101928433 CAGGAGGAAGAGAGTGAAGGGGG - Intergenic
935699222 2:105796509-105796531 CCGGTTGCAGAGAGGGCCTGGGG + Intronic
935706509 2:105861946-105861968 CAGGTGGAAGAAAGGGAAGGGGG - Intronic
936072631 2:109381502-109381524 CACGCTGAAGGGAGGGCAGGTGG - Intronic
936376766 2:111947704-111947726 CAGGTAGACGGGAAGGCAGGTGG + Intronic
936518423 2:113197084-113197106 TAGGGGGAAAAGAGGGCAGGTGG + Intronic
936928792 2:117765276-117765298 GAGGGTGAAGGGAGGGAAGGAGG + Intergenic
937146052 2:119645726-119645748 GAGGCTGAAGGTAGGGCAGGAGG - Intronic
937248428 2:120509041-120509063 AGGGATGAAGAGAGTGCAGGGGG + Intergenic
937303259 2:120856236-120856258 CAGGAGGGAGTGAGGGCAGGGGG + Intronic
937361145 2:121231037-121231059 CAGGTTGAACAGTGGGTAAGGGG - Intronic
937474526 2:122203132-122203154 CAGTTTCAATAGAGGGAAGGGGG + Intergenic
939039554 2:137171820-137171842 AAGGATGAAGAGAGGGAGGGAGG - Intronic
939195948 2:138972394-138972416 CAGGGTGGAGAGAAGGCAGGAGG + Intergenic
939687314 2:145215141-145215163 CAGGAGGAAGAGAGAGAAGGGGG + Intergenic
939692045 2:145275473-145275495 CAGGAGGAAGAGAGAGAAGGGGG - Intergenic
939830339 2:147063809-147063831 CAGGTTGAGGTGAGTGCAGATGG + Intergenic
939867237 2:147486348-147486370 CGGGTGGAAGAGAGGGCATGCGG - Intergenic
940113259 2:150179101-150179123 AATGTGGAAGAGAAGGCAGGCGG + Intergenic
940280563 2:151984809-151984831 TATGTTGTAGAGATGGCAGGAGG - Intronic
940920050 2:159296194-159296216 CAGGCCAAAGAGATGGCAGGGGG + Intergenic
940971543 2:159901987-159902009 TAGGTTGAAGAGCTGGAAGGAGG + Intronic
941127624 2:161604664-161604686 CAGGTTGTAGAGAGTACAGTTGG + Intronic
941269321 2:163405706-163405728 CAGGTTGCAAAGAGTGGAGGGGG - Intergenic
941658451 2:168169839-168169861 CAGGTAAAAGAAGGGGCAGGGGG + Intronic
941728827 2:168893054-168893076 CAGGAGCAAGAGAGGTCAGGAGG + Intronic
942123568 2:172801918-172801940 CAGATCAAAGAGAGGGTAGGAGG - Intronic
942617488 2:177809097-177809119 CAGGCTGAAGAGAGGGGAGTGGG + Intronic
943691180 2:190871234-190871256 GAGGAGGAAGAGAGAGCAGGGGG + Intergenic
944964120 2:204910157-204910179 CAGGATGAAGAGAAAGCAGTTGG + Intronic
945041859 2:205749183-205749205 AAGGTTGGAGAGAGAGGAGGTGG - Intronic
946027627 2:216681380-216681402 CTGGATAAAGTGAGGGCAGGTGG + Intronic
946480079 2:220046829-220046851 CAGAGTGTTGAGAGGGCAGGGGG - Intergenic
946736124 2:222756400-222756422 CAAGGTGCAGAGAGGACAGGAGG - Intergenic
947463585 2:230323170-230323192 CGGGCTGAACAGAGGGCAGGCGG + Intergenic
947472421 2:230411733-230411755 CGGGCTGAACAGAGGGCAGGCGG + Intergenic
947624884 2:231613231-231613253 CAGGTTGGAGAAGGGGCAGCTGG - Intergenic
947709617 2:232304684-232304706 CAGGCTGCAGAGAGGACAGCCGG - Intronic
948230942 2:236348990-236349012 CAGGATGGAGGGAGGGAAGGTGG - Intronic
948494316 2:238337029-238337051 CAGGGTGGAGAGGGGGCAGAGGG + Intronic
948659904 2:239500684-239500706 CAGGATGAAGAGAGGACAGCAGG - Intergenic
1169810690 20:9606227-9606249 CAGGAGGAAGAGAGGGCGGCAGG - Intronic
1169996351 20:11561608-11561630 AAGGTAGAAGAGAAGGGAGGTGG - Intergenic
1171148976 20:22810311-22810333 CTGGTTCAAGAAGGGGCAGGAGG + Intergenic
1171204264 20:23266905-23266927 GAGGTAGGAGATAGGGCAGGTGG + Intergenic
1171403712 20:24895561-24895583 CAGGAAGAAGAGAGAGCAGGAGG + Intergenic
1172307279 20:33889545-33889567 CAGCCTGAGGAGAAGGCAGGTGG - Intergenic
1172719515 20:36988866-36988888 CAGGAGGAAGAGAGAGCAGGGGG - Intergenic
1173249833 20:41358584-41358606 CAGGGAGAAGCCAGGGCAGGGGG - Intronic
1173418041 20:42876034-42876056 GAGGATGGAGAGAGGGAAGGAGG - Intronic
1173552315 20:43941147-43941169 CAGGGTGATGTGAGGGAAGGGGG + Intronic
1173571034 20:44076247-44076269 CAGGTTGAGAAGAGGTCACGAGG + Intergenic
1173705158 20:45104799-45104821 CAGGGTAAAGAAAGGGCAGGAGG - Intergenic
1173718905 20:45236111-45236133 CAGGCGGAAGTGAGGGCAGCGGG + Intergenic
1174047029 20:47740997-47741019 TACGTTGAAGAGAGGGCAACAGG - Intronic
1174688119 20:52475208-52475230 CAGGTTACAGAGAGATCAGGTGG + Intergenic
1174925126 20:54750788-54750810 CAGGAGGAAGAGAGAGAAGGGGG + Intergenic
1174981582 20:55401479-55401501 CAGGAGGAAGAGAGTGAAGGAGG - Intergenic
1175199130 20:57266175-57266197 CAGGTGGCAGAGGGGGCAGGCGG + Exonic
1175274923 20:57761873-57761895 AAGGAGGAAGAGAGAGCAGGGGG + Intergenic
1175318254 20:58067229-58067251 CATGTTGAAGGAAGGGCTGGAGG + Intergenic
1175652455 20:60737348-60737370 CAGGAGGAAGAGAGCGAAGGGGG - Intergenic
1177143901 21:17386754-17386776 GGGGTTGAAGAGAGGCAAGGAGG - Intergenic
1177521038 21:22226300-22226322 CAGGTTGAATAGAAGTAAGGAGG - Intergenic
1177614622 21:23500790-23500812 CAGGAGGAAGAGAGGTCTGGGGG - Intergenic
1177775551 21:25562287-25562309 CACGTTCAAGAGAGGAAAGGCGG - Intergenic
1179030854 21:37718389-37718411 CAGATAGAAGAGTGGTCAGGGGG + Intronic
1179170704 21:38970733-38970755 CCGTGGGAAGAGAGGGCAGGTGG - Intergenic
1179237436 21:39560083-39560105 CAGGAGGAAGAGAGAGCAAGGGG - Intronic
1179239838 21:39580336-39580358 CAGGTAGAAGAGAGAGAAGGGGG - Intronic
1179555699 21:42174233-42174255 CAGGCTGGAGAGGAGGCAGGTGG + Intergenic
1179598733 21:42461395-42461417 CAGGAGGAAGAGAGAGAAGGAGG - Intergenic
1179714303 21:43279882-43279904 CAGGTGGAGGGGAGGGGAGGTGG + Intergenic
1180182628 21:46124731-46124753 CAGGTTGGGGGGAGGGCATGGGG - Intronic
1180319530 22:11307704-11307726 CAGGGTGCAGAGAGGGGTGGTGG + Intergenic
1180837531 22:18937736-18937758 AGGGCTGCAGAGAGGGCAGGGGG + Intergenic
1181063533 22:20293770-20293792 AGGGCTGCAGAGAGGGCAGGGGG - Intergenic
1181388817 22:22564388-22564410 CTGGGTGTACAGAGGGCAGGAGG + Exonic
1181539591 22:23566268-23566290 CTGGGAGAGGAGAGGGCAGGGGG + Intergenic
1181752100 22:24996037-24996059 CTGGGAGAAGTGAGGGCAGGTGG + Intronic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
1182208362 22:28651720-28651742 TATGTTTAAGAGAGGTCAGGAGG - Intronic
1182740245 22:32562316-32562338 CAGGCTGAGGACAGGGCAGCGGG + Intronic
1182866190 22:33606588-33606610 CAGGGTGGAGAGAGAGCACGGGG - Intronic
1183069106 22:35383962-35383984 CAGGTTGAACAGAGGGTGTGGGG + Intronic
1183272115 22:36868678-36868700 AAGGAGGAAGAGAAGGCAGGAGG + Intronic
1183455809 22:37922432-37922454 CAGGGTGCAGTCAGGGCAGGGGG + Intronic
1183485209 22:38084670-38084692 CAGGTCGAAATGAGAGCAGGTGG + Intergenic
1183487582 22:38097697-38097719 CAGGCAGGAGAGAGGGGAGGAGG + Intronic
1183498076 22:38161797-38161819 CAGGCTGAGGGGAGGGAAGGAGG + Intronic
1184208940 22:43023870-43023892 CAGGTGGGAGACAGGGCAGGGGG + Intergenic
1184842190 22:47058557-47058579 CAAGCAGAAGAGAGGGCAGAGGG - Intronic
1185197135 22:49478697-49478719 CAGGAGGAAGAGAGGGGAGGGGG + Intronic
1203287624 22_KI270734v1_random:163035-163057 AGGGCTGCAGAGAGGGCAGGGGG + Intergenic
949127826 3:467770-467792 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
950342169 3:12257327-12257349 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
950886583 3:16367734-16367756 CAGGTTGAAGAGTGGGGTGACGG + Intronic
950924646 3:16728416-16728438 GAGGGTGAAAAGGGGGCAGGCGG + Intergenic
952082101 3:29771803-29771825 CAGGAGGAAGAGAGTGAAGGAGG + Intronic
952085124 3:29811576-29811598 CATGCTGAAGAGAAGGCATGAGG + Intronic
952221251 3:31326429-31326451 CAGGAGGAAGAGAGAGCAGAGGG + Intergenic
952540493 3:34362545-34362567 CAGCTTGAAAAGAAGCCAGGTGG + Intergenic
952952910 3:38538900-38538922 CAGGCTGCAGGCAGGGCAGGAGG - Intronic
953256621 3:41296916-41296938 CAGGAAGAAGAGAGGGATGGAGG + Intronic
953770086 3:45772881-45772903 CAGGTTGAAGGGAGGGTGGAAGG - Intronic
953932261 3:47011339-47011361 CAGGTTGAAGTGAGAAAAGGGGG + Intergenic
954117226 3:48473561-48473583 CAGATTGGAGAGAGTGCTGGTGG - Intronic
955072306 3:55582027-55582049 CAGCTTGTACAGAGGCCAGGAGG - Intronic
956609823 3:71111297-71111319 CACGTTTAAGAGAGGGCACTTGG - Intronic
956732889 3:72213237-72213259 CAGGAGGAAGAGAGGGAGGGAGG + Intergenic
956754085 3:72368374-72368396 CAGGGGGAAGAGAGGGAAGGTGG - Intergenic
957114161 3:76003191-76003213 CAGGATTAAGAGAGGGCATAGGG - Intronic
957326800 3:78706223-78706245 CAAGTAGAAGATGGGGCAGGTGG + Intronic
957698170 3:83671554-83671576 CAGGAGGAAGAGAGGGAAGGGGG - Intergenic
958005176 3:87801567-87801589 CATCTTGAAGCAAGGGCAGGAGG + Intergenic
960009006 3:112812894-112812916 CCAGTTGAAGAGAGGGCTTGGGG - Intronic
960316160 3:116179619-116179641 CAGGAGGAAGAGAGTGAAGGGGG + Intronic
960369974 3:116823220-116823242 GAGAGTGAAGAGAGGGGAGGTGG + Intronic
960913563 3:122674548-122674570 CAGGAGGAAGAGAGAGAAGGGGG + Intergenic
960969528 3:123129755-123129777 CAGGCTCCAGAGAGGTCAGGCGG + Intronic
961115099 3:124322499-124322521 CAGATGGAAGAGAGTGGAGGGGG + Intronic
961387254 3:126529751-126529773 CAGGATGATGGGAGGGGAGGAGG - Intronic
962018305 3:131467595-131467617 CAGGAGGAAGAGAGGGAAGGGGG - Intronic
962205248 3:133428801-133428823 CAGGTCAGAGCGAGGGCAGGCGG - Intronic
962997837 3:140649277-140649299 CAGGAGGAAGAGAGAGTAGGGGG + Intergenic
963055213 3:141180995-141181017 CAGGTTCAAGAAAGGCTAGGAGG - Intergenic
963987772 3:151617155-151617177 GAGGAGGAAGAGAGGGGAGGGGG - Intergenic
964464960 3:156981709-156981731 CAGGTTGCTCAGAGGTCAGGAGG + Intronic
965634735 3:170769552-170769574 CAGGTCTAGGGGAGGGCAGGAGG + Intronic
966450161 3:180050034-180050056 GAGGGTGAAGAGGGGGAAGGAGG - Intergenic
966618215 3:181935044-181935066 CTGGATGAAGAGAGAGAAGGGGG + Intergenic
966948713 3:184796605-184796627 CAGGATGAAAAGAGGGCCGGCGG + Intergenic
966988891 3:185208307-185208329 CAGGTTGATTAGGGGTCAGGGGG - Intronic
967126291 3:186427537-186427559 CAGGTTGCAGGCAGGGCTGGTGG - Intergenic
967430177 3:189374658-189374680 CAGGAGGATGAGAGGGCAGCTGG - Intergenic
967594043 3:191309750-191309772 CAGGAGGAAGAGAGAGCAAGAGG - Intronic
968114909 3:196081990-196082012 CAGGATGAAGGGAGGACACGAGG + Intronic
968254777 3:197258551-197258573 CAAGTGGGAGAGAGGGGAGGCGG + Intronic
968267123 3:197370889-197370911 CAGGATGAAGCAAGGGTAGGGGG - Intergenic
968593983 4:1473077-1473099 CAGGTGGCAGGGTGGGCAGGTGG - Intergenic
968840934 4:3005355-3005377 GAGGTTAAAGAGAGGGAAGATGG + Intronic
968910658 4:3475615-3475637 CTGGATGGAGAGAGGGCCGGTGG + Intronic
968943090 4:3649321-3649343 CAGGATGAACACAGGGAAGGAGG - Intergenic
969344148 4:6560862-6560884 CAGGTTGGGGAGGTGGCAGGAGG - Intronic
969699719 4:8761504-8761526 GAGGTGGAAGAGAGAGCAGCTGG - Intergenic
970163769 4:13215064-13215086 CAGGTTGAGGATAGAGAAGGGGG - Intergenic
970935603 4:21566468-21566490 CAGGAGGAAGAGAGCGAAGGGGG - Intronic
970984511 4:22140642-22140664 CAGGAGGAAGAGAGCGAAGGCGG + Intergenic
971005663 4:22371746-22371768 CAGGAGGAAGAGAGAGAAGGGGG - Intronic
971454774 4:26834088-26834110 CAGGAGGAAGAGAAGGAAGGGGG - Intergenic
971759459 4:30746401-30746423 CAGCGTGAAGGGAGAGCAGGGGG + Intronic
972688523 4:41373931-41373953 CAGGAGGAAGAGAGAGCAGGGGG - Intronic
972736423 4:41846102-41846124 CAGGAGGAAGAGAAGGAAGGGGG - Intergenic
972878713 4:43396828-43396850 CAGGAGGAAGAGAGAGAAGGGGG - Intergenic
973015053 4:45127675-45127697 CAGGAGGAAGAGAGAGCATGGGG - Intergenic
973039302 4:45450850-45450872 AAGGCTGAAGAGAGGGCAATGGG - Intergenic
973646572 4:52956428-52956450 CAGGCTGAGGGAAGGGCAGGTGG + Intronic
973933419 4:55817092-55817114 CAGGAGGAAGAGAGAGAAGGAGG - Intergenic
974103601 4:57443420-57443442 CAGGCTGACAAGAGGGCAGGGGG - Intergenic
974789706 4:66671576-66671598 TAGGTTGAAGGGAGGGGCGGCGG - Intergenic
975176950 4:71300010-71300032 GAACTTGATGAGAGGGCAGGAGG + Intronic
975693063 4:76984698-76984720 TAGGATAAAGACAGGGCAGGAGG + Intronic
975948334 4:79736701-79736723 CAGGAGGAAGAGAGAGAAGGGGG - Intergenic
975989394 4:80241666-80241688 CATGTTGAAGACAGAGCAGCAGG - Intergenic
977580003 4:98714506-98714528 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
978338958 4:107701216-107701238 CAGGAACAAGAGAGGTCAGGTGG - Exonic
978344733 4:107755416-107755438 CAGGAGGAAGAGAGTGAAGGGGG - Intergenic
979595321 4:122528258-122528280 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
980245542 4:130235296-130235318 CAGGTTGATGTGAGAACAGGAGG - Intergenic
980406909 4:132365700-132365722 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
980742512 4:136970825-136970847 CAGCTTGATGAGAGTGCAGAAGG - Intergenic
980879301 4:138693222-138693244 CAGGAGGAAGAGAGAGCAGCAGG - Intergenic
981173896 4:141658180-141658202 CAGGAGGAAAAGAGAGCAGGGGG - Intronic
981912283 4:149995495-149995517 CAGGTGAGAGAGAGGGAAGGAGG + Intergenic
982829335 4:160041790-160041812 CAGGATGAAAAGATGGCAGAAGG + Intergenic
983294591 4:165850143-165850165 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
983506853 4:168562692-168562714 ATGTTTGAAGAGAGGGAAGGAGG + Intronic
984352424 4:178612876-178612898 CAGGAGGAAGAGAGAGAAGGGGG - Intergenic
984529713 4:180901654-180901676 CAGGAGGAAGAGAGAGCGGGGGG + Intergenic
985042723 4:185907755-185907777 CAGGAAGGAGAGAGGGAAGGAGG - Intronic
985297399 4:188449857-188449879 CAGGGGGAAGAAAGCGCAGGTGG - Intergenic
986511598 5:8512798-8512820 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
986577667 5:9229417-9229439 CAGGCTGAAGAGAACACAGGAGG + Intronic
987120186 5:14760053-14760075 CAGGTCGGGGAGAGTGCAGGAGG + Intronic
987289417 5:16494541-16494563 CAGGAGTAAGAGAGAGCAGGGGG - Intronic
988078767 5:26388710-26388732 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
988440248 5:31225585-31225607 CAGGAGGAAGAGAGAGAAGGGGG + Intronic
988929014 5:36017175-36017197 CATGTTGTAGAGTGGGCATGTGG + Intergenic
989239021 5:39182230-39182252 CAGTGTGAACAGAGTGCAGGTGG + Intronic
989513468 5:42315619-42315641 CAGGTTTTAAAGAGGGCAGTAGG - Intergenic
990019452 5:51107416-51107438 CAGGTAGAGGAGAGGGGAGACGG - Intergenic
990368758 5:55095662-55095684 CAGGTTGAGTAGAGGGTAGAGGG - Intergenic
990618093 5:57528582-57528604 CAGGTTGGGGAGGTGGCAGGAGG - Intergenic
990726868 5:58765940-58765962 GAGGAAGAAGAGTGGGCAGGGGG - Intronic
990747465 5:58974725-58974747 CAGGTTGAAGAGGAGGCAGTAGG - Exonic
991163304 5:63531228-63531250 CAGGAGGAAGAGAGTGAAGGGGG - Intergenic
991404006 5:66284079-66284101 CAGATTGAAAGGAGTGCAGGAGG + Intergenic
991448024 5:66721271-66721293 TGGGTTCAAGAGAGAGCAGGGGG - Intronic
991449037 5:66732272-66732294 AAGGTGGAAGAAAGGGCAGTAGG - Intronic
991950058 5:71938857-71938879 CAAGATGAGGAGAGAGCAGGTGG - Intergenic
992041853 5:72842660-72842682 CAGTTTGCAATGAGGGCAGGAGG - Intronic
992234305 5:74693410-74693432 CAGGTTGAAGTGTGCGGAGGAGG + Intronic
992648782 5:78836921-78836943 CAGGAGGAAGAGAGCGAAGGGGG + Intronic
992959697 5:81946367-81946389 CAGGAGGAAGAGAGTGAAGGGGG - Intergenic
993043320 5:82839711-82839733 CATGTTGCAGGGAGAGCAGGAGG + Intergenic
993189985 5:84669435-84669457 CAGGAGGAAGAGAGTGAAGGAGG - Intergenic
993408706 5:87547231-87547253 CAGGGTGAAGAGTGAGCATGGGG - Intergenic
993948087 5:94138680-94138702 CAGGGAAAAGAGTGGGCAGGGGG - Intergenic
994080730 5:95706385-95706407 CAGGAGGAAGGGAGGGAAGGGGG - Intergenic
994081613 5:95713458-95713480 CAGGAGGAAGGGAGGGAAGGGGG - Intergenic
994165991 5:96608826-96608848 CAGGCAGAAGAAAGAGCAGGAGG + Intronic
995067296 5:107876622-107876644 AAGGTTGATGAGAAGGGAGGAGG - Intronic
995183469 5:109249688-109249710 CAGCTTGAAGAGAGGGACGGGGG + Intergenic
995492276 5:112705924-112705946 AAGGTTGGAGAGAGAGCAGATGG - Intergenic
996538912 5:124608555-124608577 CAGAGTGAAGAGAAGGCAGATGG + Intergenic
996862560 5:128083325-128083347 CTGGGTGGAGAGAGGGGAGGTGG + Intergenic
997142480 5:131397524-131397546 CAGATTGAAAAGAGGGAAGAAGG - Intronic
997273624 5:132563902-132563924 CAGGAGGAAGAGAGTGAAGGGGG - Intronic
998661673 5:144245750-144245772 CAGGATGAAGAGAGAGGAGGGGG - Intronic
998803965 5:145900272-145900294 CAGGAGGAAGAGAGTGAAGGGGG - Intergenic
998930235 5:147173481-147173503 CAGGAGGAAGAGAGTGAAGGGGG - Intergenic
999297147 5:150466841-150466863 CAGGAGGAAAAGAAGGCAGGAGG - Intergenic
999806143 5:155083106-155083128 GAGGTTGAAGGGTGGGCAGTAGG + Intergenic
999829713 5:155306960-155306982 CAGGTAGATGGGAGGGGAGGTGG + Intergenic
999925024 5:156366178-156366200 CTGTGTGAAGAGAGGGCATGTGG + Intronic
999930732 5:156430989-156431011 CTGGTTGTAGATAAGGCAGGTGG + Intronic
1000147887 5:158471043-158471065 CTGGTTGAAGAGAAAGGAGGAGG + Intergenic
1001695320 5:173665514-173665536 CAGGTTGCAGAGACGCCAGTGGG - Intergenic
1002295205 5:178226760-178226782 CAGGTAAAAGGAAGGGCAGGAGG + Intronic
1002813613 6:658242-658264 CAGGTTCAAGATAGGGCAGTGGG - Intronic
1002937734 6:1687818-1687840 GTGGTTGGAGAGAGGGCATGGGG + Intronic
1003019732 6:2499252-2499274 CAGGAGGAAGAGAGTGAAGGAGG + Intergenic
1003369190 6:5508461-5508483 CAGAATGCAGAGAGGCCAGGAGG + Intronic
1003964040 6:11236294-11236316 TTGGTTGAAGAGCAGGCAGGCGG - Intronic
1004022530 6:11788251-11788273 AAGGATGAGGAGAGGGCAGAGGG - Intronic
1004076990 6:12352718-12352740 CAGGAGGAAGAGAGTGAAGGAGG + Intergenic
1004201152 6:13549226-13549248 CAGGAGGAAGAGAGTGAAGGAGG - Intergenic
1004317538 6:14603245-14603267 CAGGAGGAAGAGAGAGAAGGGGG - Intergenic
1004465722 6:15883066-15883088 CAGGCTGCAGAGAGGACGGGTGG + Intergenic
1005882046 6:30069378-30069400 CAGGCAGAAGAGAGGGAAGGAGG - Exonic
1006199716 6:32277162-32277184 CAGGAGGAAGAGAGAGAAGGGGG - Intergenic
1007565196 6:42844694-42844716 CAGACTGAGGAGAGAGCAGGAGG + Intronic
1008457743 6:51730925-51730947 GAGGTTGAAGGGAGGGAAGAGGG + Intronic
1008648347 6:53539232-53539254 CAGGATGAGGAGAGGTAAGGGGG - Intronic
1011848800 6:91600719-91600741 CAGGAGGAAGAGAGTGAAGGTGG - Intergenic
1012372669 6:98526520-98526542 CTTGTTCAAGCGAGGGCAGGAGG - Intergenic
1012804900 6:103881396-103881418 GAGGTTGAAGGAAGGGGAGGGGG + Intergenic
1013294065 6:108743231-108743253 CAGCTTCAAGAGCGGGCTGGAGG - Intergenic
1013412952 6:109897944-109897966 AGGGTTGGAGAGAGGGCAGCAGG + Intergenic
1013650541 6:112190269-112190291 CAGGCTAAAGAGAGAGAAGGCGG - Intronic
1013874783 6:114811966-114811988 CAGGAGGAAGAGAGAGCAAGGGG - Intergenic
1015416858 6:132959026-132959048 GAGGATGAAGAGAGGGCATTTGG + Intergenic
1015602845 6:134927109-134927131 CAGGTTAAAGAGAGGGCCCCTGG + Intronic
1016393437 6:143597906-143597928 CAGGTAGAAAATATGGCAGGTGG - Intronic
1016568053 6:145480302-145480324 CAGGAGGAAGAGAGGGAAGGGGG + Intergenic
1016648816 6:146440619-146440641 CTGGTAGAAGAGCGGGCAAGAGG + Intergenic
1016832262 6:148445702-148445724 CAGGGCGAAGAGAGGGAAGAAGG + Intronic
1017230229 6:152065661-152065683 ACGGTTGAAGAGAGGACAGAGGG - Intronic
1017637345 6:156456162-156456184 GAGGGGGAAGAGAGGGGAGGAGG - Intergenic
1017939136 6:159036105-159036127 CAGGTGGAAGAGGGGGTAGGAGG + Exonic
1017952458 6:159147523-159147545 CAGGAGGAAGAGAGAGCAGGGGG + Intergenic
1018047182 6:159975539-159975561 CAGGTGGAAGGAGGGGCAGGTGG + Intronic
1018217132 6:161539377-161539399 CAGGTTTAAGAGTGGCCAGCCGG + Intronic
1018323046 6:162633783-162633805 CAGGATGAAGCGAGGGAGGGAGG + Intronic
1019483577 7:1277285-1277307 GAGGGAGAAGAGAGGGAAGGAGG - Intergenic
1019534938 7:1523904-1523926 CAGGAAGAAGCGAGGGTAGGAGG + Intergenic
1019608193 7:1920688-1920710 CAGTGAGAAGAGAGGACAGGAGG + Intronic
1019665988 7:2252617-2252639 CAGGGTGAAGGGGGGGCTGGAGG - Exonic
1019859297 7:3643028-3643050 CAGGTAGGGGAGAGAGCAGGTGG - Intronic
1019936743 7:4262852-4262874 GAGGTAGAAGGGAGGGGAGGGGG - Intronic
1019936774 7:4262924-4262946 GAGGTAGAAGGGAGGGGAGGGGG - Intronic
1019975052 7:4574459-4574481 CAGGAGGAAGAGAGAGAAGGGGG - Intergenic
1020009890 7:4802020-4802042 CAGGTAGAGGAGTGGCCAGGTGG + Intronic
1020890884 7:13876563-13876585 CAGGAGGAAGAGAGAGAAGGGGG + Intergenic
1021519811 7:21527748-21527770 CAGGAAGAATAGAGAGCAGGGGG - Intergenic
1022822585 7:33975351-33975373 CAGGTTGCAGAGTGGATAGGAGG + Intronic
1023111665 7:36818918-36818940 CAGGTGGGAGAGAAGGCAGACGG - Intergenic
1023275538 7:38515411-38515433 CAGGAGGAAGAGAGTGAAGGAGG - Intronic
1023959241 7:44912966-44912988 GAGGCTGAAGGGAGGGCAGCAGG - Intergenic
1024201904 7:47116770-47116792 CAGGTTGAACATAGCCCAGGAGG + Intergenic
1024471115 7:49769632-49769654 AGGAATGAAGAGAGGGCAGGAGG - Intergenic
1024499942 7:50093958-50093980 CTGGGTAAAAAGAGGGCAGGTGG - Intronic
1026054281 7:66971084-66971106 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
1026302794 7:69112377-69112399 CAGGAGGAAGAGAGAGAAGGGGG + Intergenic
1026890235 7:73977454-73977476 CTGGCTGAAGAAAGGGCAGGTGG + Intergenic
1028110087 7:86929864-86929886 CAGGAGGAAGAGAGAGAAGGGGG - Intronic
1028210563 7:88069170-88069192 CAGGGAGAAGAGAGGGAAAGAGG - Intronic
1029124501 7:98287226-98287248 CCGCTTAAAGAGAGGGTAGGAGG - Intronic
1029159384 7:98540931-98540953 CAGGGAGTAGGGAGGGCAGGAGG + Intergenic
1029174503 7:98655038-98655060 CAGGAGGAAGAGAGAGAAGGGGG - Intergenic
1029174719 7:98656446-98656468 CAGGAGGAAGAGAGAGAAGGGGG + Intergenic
1029457460 7:100678441-100678463 CAGGTCGAAGAGGCGGCACGTGG - Exonic
1031284324 7:119844671-119844693 GAAGTTGAAGAGAGAGAAGGTGG + Intergenic
1031451274 7:121923143-121923165 CAGGTAGAAGAAAAGGCATGAGG - Intronic
1033605765 7:142927584-142927606 CAGGAGGAAGAGAGAGCAGGAGG + Intronic
1033605769 7:142927600-142927622 CAGGAGGAAGAGAGAGCAGGGGG + Intronic
1033648801 7:143324364-143324386 CAGGTGGAAGAGAGGGAGGTGGG - Intronic
1034262661 7:149766399-149766421 CAGGTTCAGGAGAATGCAGGAGG - Intronic
1034635472 7:152563921-152563943 CAGCTTAGTGAGAGGGCAGGAGG + Intergenic
1035085910 7:156257759-156257781 CAGGAGGAAGAGAGGGACGGGGG + Intergenic
1035449106 7:158963951-158963973 CAGGTGGAAGAGGGGCCAGGTGG - Intergenic
1035587830 8:789348-789370 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
1036120027 8:6006216-6006238 CAGGAGGAAGAGAGAGGAGGGGG + Intergenic
1036134666 8:6149666-6149688 CAGGAGCAAGAGAGGGGAGGGGG + Intergenic
1037002103 8:13732385-13732407 CAGGTAGAAAAGAAGGCAGGAGG - Intergenic
1037565991 8:20118965-20118987 CAGGGGGAAGAGAGAGAAGGGGG - Intergenic
1037607272 8:20448449-20448471 CAGGTTGGAGAGATGCCTGGCGG - Intergenic
1037799964 8:22027532-22027554 CAGGTTGAAGGGGAGGCGGGTGG - Intronic
1037932634 8:22891352-22891374 GAGGTAGGACAGAGGGCAGGAGG - Intronic
1038870063 8:31484028-31484050 CAGGAGGAAGAGAGAGAAGGGGG + Intergenic
1039671202 8:39601070-39601092 CAGGAGGAAGAGAGAGGAGGAGG + Intronic
1039912475 8:41835946-41835968 CAGGGAGGGGAGAGGGCAGGGGG + Intronic
1040466807 8:47702918-47702940 CAGTCTCAAGGGAGGGCAGGAGG + Intronic
1041256490 8:55983534-55983556 GAGGTTCAAGAGAGGGCGGGTGG - Intronic
1042324013 8:67509030-67509052 CAGGAGGAAGAGAGCGAAGGGGG + Intronic
1042566425 8:70116775-70116797 CAGCATGAAGAAAGTGCAGGTGG + Intronic
1042739068 8:72022977-72022999 CAGGTTTAAGAAAGAGCAGATGG - Exonic
1043145532 8:76648861-76648883 CAGGAGGAAGAGTGTGCAGGGGG - Intergenic
1043890061 8:85644356-85644378 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1043891602 8:85656270-85656292 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1043892674 8:85663107-85663129 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1043892883 8:85714228-85714250 CAGGCTGATGAGAGGGCAGTGGG - Intergenic
1043895570 8:85735682-85735704 CAGGCTGATGAGAGGGCAGTGGG - Intergenic
1043897109 8:85746126-85746148 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1043899435 8:85764494-85764516 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1043901043 8:85776687-85776709 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1043903007 8:85791962-85791984 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1043904617 8:85804155-85804177 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1043906229 8:85816346-85816368 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1043907837 8:85828536-85828558 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1044681115 8:94778537-94778559 CAGGTTGAAGAAAGTGGAAGCGG - Intronic
1044861166 8:96525347-96525369 CAGGTGGAAGTGAGCACAGGTGG - Intronic
1045231990 8:100314678-100314700 CAGGCAGAGGAGAGGGGAGGGGG - Intronic
1045889280 8:107135194-107135216 CAGGAGGAAGAGAGTGAAGGGGG - Intergenic
1045959174 8:107946950-107946972 AAGGTTGGAGAGAAGGCAGCAGG + Intronic
1046521480 8:115331227-115331249 GAGGGTGAAGAGAGGACATGAGG - Intergenic
1047937870 8:129799741-129799763 CAGGAGGAAGAGAGAGAAGGAGG + Intergenic
1048410951 8:134171974-134171996 CAGGTTGAAGGGAAGTCAAGAGG - Intergenic
1048694041 8:137004128-137004150 AAGGTTGAAGTGTGGGCAGCTGG - Intergenic
1048819497 8:138367660-138367682 TAGGTAGAAGGGAGTGCAGGGGG + Intronic
1049134772 8:140886325-140886347 CAGGTTGAAGAAAGTGGACGAGG + Intronic
1049371913 8:142272008-142272030 CGGGTAGACCAGAGGGCAGGCGG - Intronic
1049374782 8:142284238-142284260 CTGGAGGAAGACAGGGCAGGAGG + Intronic
1049602062 8:143512595-143512617 CGGCCTAAAGAGAGGGCAGGAGG + Intronic
1049653035 8:143784333-143784355 AAGGAGGAAGAGAGAGCAGGGGG - Intergenic
1051366521 9:16325224-16325246 TAGGCTGAAGAGAGGAGAGGTGG - Intergenic
1051718231 9:20008195-20008217 CAGGCTTAAGAGAGGGAAGAGGG - Intergenic
1052391472 9:27883237-27883259 CAGGAGGAAGAAAGAGCAGGCGG - Intergenic
1053440203 9:38109727-38109749 CAGGCTGAAGAGAGGGCAGCTGG + Intergenic
1053900931 9:42794875-42794897 CAGGGAGAAGAGTGGGCAGCAGG + Intergenic
1054260715 9:62862668-62862690 CAGGGTGAAGAGTGGGCAGCAGG - Intergenic
1055766884 9:79672916-79672938 CAAGTGCAAGTGAGGGCAGGTGG + Intronic
1055777153 9:79778912-79778934 GAGGTTGATGGGGGGGCAGGTGG - Intergenic
1056233981 9:84573558-84573580 TAGGTTGAATAGAGGGGATGGGG - Intergenic
1056546916 9:87620859-87620881 CAGGCTGAAGAGATGCCTGGAGG + Intronic
1056733334 9:89184122-89184144 CAGGATGAAGAGAGAGCAAAGGG - Intergenic
1057291412 9:93809707-93809729 CTGGCTGAAGAGAGGGCACCAGG + Intergenic
1057524592 9:95787133-95787155 CAGGATAAAGAGAGTGGAGGGGG - Intergenic
1057535904 9:95906151-95906173 GAGTTTCAAGAGAGAGCAGGAGG + Intronic
1057684859 9:97222382-97222404 CAGGTGGAGGAGTGGGCGGGAGG - Intergenic
1058189118 9:101891549-101891571 CAGGAGCAAGAGAGAGCAGGGGG + Intergenic
1058419996 9:104824428-104824450 TAGGTTAAAGAAAGAGCAGGAGG + Intronic
1058705747 9:107636948-107636970 GAGGAAGAAGAGAGGGTAGGGGG + Intergenic
1059822047 9:117984221-117984243 CAGCTTGTAGAGAGGCCAGGTGG + Intergenic
1059897836 9:118888118-118888140 CAGGTTGAAGACAGACAAGGAGG - Intergenic
1060257582 9:122046281-122046303 CAGGAGGAAGAGAGAGAAGGAGG - Intronic
1060705094 9:125791552-125791574 CAGGAGGAAGAGAGGGCAGGGGG - Intronic
1060820399 9:126658415-126658437 CAGGCGGCAGGGAGGGCAGGGGG - Intronic
1060894892 9:127211267-127211289 CAGGTGGAGGAGAGGAGAGGGGG + Intronic
1060912841 9:127364309-127364331 GAGGTGGGAGAGAGGGCAGGAGG + Intronic
1061328547 9:129878568-129878590 CAGGGTGAACAGAGAGCATGGGG + Intronic
1061466523 9:130784973-130784995 CAGGTTGAAGGGAAGGCACTGGG - Intronic
1061480561 9:130895953-130895975 TAGTCTGATGAGAGGGCAGGCGG + Intergenic
1061845183 9:133383982-133384004 CTGGATGAAGAGAAGGCTGGAGG + Intronic
1062075889 9:134589820-134589842 CAGGCTGAGGAGACAGCAGGAGG - Intergenic
1062469398 9:136695937-136695959 CAGGATGCACAGAGGGAAGGGGG - Intergenic
1062526252 9:136979130-136979152 CAGGTGGGACAGCGGGCAGGTGG + Exonic
1062721123 9:138044696-138044718 CAGGTGGACGGGAGGGCAGAGGG + Intronic
1203793205 EBV:162465-162487 CTGGGTGAAGATGGGGCAGGCGG + Intergenic
1203697146 Un_GL000214v1:109268-109290 CAGGTGGAGGAGTGGGCGGGAGG - Intergenic
1203444728 Un_GL000219v1:44749-44771 AAGGAGGAAGAGAGGGAAGGAGG - Intergenic
1185688331 X:1948454-1948476 GAGGAGGAAGAGAGGGGAGGAGG + Intergenic
1185688609 X:2133976-2133998 GAGGAGGAAGAGAGGGGAGGAGG + Intergenic
1186306555 X:8265941-8265963 GAGGTGGAAGGGAGTGCAGGAGG + Intergenic
1187074077 X:15916526-15916548 AATGTAGAAGAGAGGGAAGGGGG - Intergenic
1187704273 X:21993902-21993924 CAGGAGGAGGAGAGGGAAGGAGG - Intronic
1187928927 X:24276208-24276230 GAGGAGGAAGAGAGAGCAGGGGG - Intergenic
1187933810 X:24316898-24316920 CAAGTGGAAGAAAGGGAAGGGGG - Intergenic
1188115456 X:26237996-26238018 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
1188156435 X:26748474-26748496 CAGGTGGAAGACAGGGGTGGCGG - Intergenic
1188294574 X:28432052-28432074 CATGTTGAAGTGAGAGTAGGTGG - Intergenic
1188822226 X:34789593-34789615 AAGGGGGAAGAGAGAGCAGGGGG - Intergenic
1188927370 X:36061149-36061171 AAGGAGGAAGAGAGGGCAGTGGG - Intronic
1189139868 X:38592049-38592071 CAGGAGGAAGAGAGTGAAGGGGG + Intronic
1189155269 X:38750324-38750346 CAGGCTGAGGAGAGGTCAGAGGG - Intergenic
1189308180 X:40002943-40002965 CAGGGTGCAGAGAGGGGAGGAGG + Intergenic
1189552659 X:42109660-42109682 CAGGTAGAAGAGAAAACAGGAGG - Intergenic
1189591766 X:42520103-42520125 CAAGTTGAAGAAAGGGAAGAAGG - Intergenic
1189644106 X:43107709-43107731 CAGGTTGCTGAGAGTGGAGGAGG + Intergenic
1191902428 X:66054335-66054357 CAGGATGTAGACAAGGCAGGTGG + Intergenic
1192171613 X:68859040-68859062 CCAGTTGAAGAGAAGGCAGTGGG + Intergenic
1192200985 X:69066577-69066599 CTGGTTGAAGGGAGAGTAGGAGG + Intergenic
1193558284 X:82984299-82984321 CAGGAGGAAGAGAGAGAAGGGGG + Intergenic
1194212460 X:91084574-91084596 CAGGAGGAAGAGAGAACAGGGGG + Intergenic
1195031183 X:100929059-100929081 CAGGATGAAGAAAAGGCTGGAGG + Intronic
1196003879 X:110814794-110814816 CAGGTTCAAGAGAGTGTAGGAGG + Intergenic
1196020492 X:110985940-110985962 GAGATTGAAGAGAAGCCAGGGGG - Intronic
1196083743 X:111661422-111661444 CAAGAGGAAGAGAGGGAAGGGGG - Intergenic
1196630644 X:117935621-117935643 CAGGAGGAAGAGAGTGAAGGGGG + Intronic
1197209169 X:123815257-123815279 CAGGCAGAAGAGAGGGAGGGAGG - Intergenic
1197915603 X:131530958-131530980 CAGGAGGAAGAGAGCGAAGGGGG - Intergenic
1198081265 X:133242029-133242051 CAGGAGGAAGAGAGCGAAGGGGG + Intergenic
1198150596 X:133904650-133904672 AATGTTGATGAGAAGGCAGGAGG + Intronic
1198421643 X:136474487-136474509 CAGGGTGAAGTGAGGGAAGGGGG + Intergenic
1198451336 X:136769014-136769036 GAGGAGGAAGAGAGGGAAGGAGG + Intronic
1198818724 X:140622157-140622179 CAGGAGGAAGAGAGGGAAGGGGG + Intergenic
1199309163 X:146302594-146302616 CAGGTTGCTGAGAGGGCAAGAGG - Intergenic
1199605976 X:149579966-149579988 CATGTTGCAGGAAGGGCAGGGGG + Intergenic
1199633145 X:149789402-149789424 CATGTTGCAGGAAGGGCAGGGGG - Intergenic
1199730028 X:150622806-150622828 CAGGTGGAAGAAAGGGGAAGGGG + Intronic
1200031883 X:153303622-153303644 CAGCTTCCAAAGAGGGCAGGAGG - Intergenic
1200273357 X:154709136-154709158 CAGGAGGAAGAGAGTGAAGGGGG - Intronic
1200962523 Y:9008435-9008457 CAGGATGAAGGGAGGCCATGAGG + Intergenic
1201153345 Y:11107331-11107353 CAGGTGGAGGAGTGGGCGGGAGG + Intergenic