ID: 1090941838

View in Genome Browser
Species Human (GRCh38)
Location 11:131393870-131393892
Sequence CTTAATAGGCTGAAGGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 201}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090941838_1090941842 -4 Left 1090941838 11:131393870-131393892 CCTACCTCCTTCAGCCTATTAAG 0: 1
1: 0
2: 0
3: 20
4: 201
Right 1090941842 11:131393889-131393911 TAAGCAAACAAAAGTGCTTGTGG 0: 1
1: 0
2: 1
3: 17
4: 283
1090941838_1090941843 14 Left 1090941838 11:131393870-131393892 CCTACCTCCTTCAGCCTATTAAG 0: 1
1: 0
2: 0
3: 20
4: 201
Right 1090941843 11:131393907-131393929 TGTGGAATGAGAAATGTAAATGG 0: 1
1: 1
2: 0
3: 61
4: 488

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090941838 Original CRISPR CTTAATAGGCTGAAGGAGGT AGG (reversed) Intronic
900806411 1:4770801-4770823 CTTGACAGGCTGCAGGAGGGTGG + Intronic
906428699 1:45736742-45736764 TTTAAAAGGCTGTAGGAGGCGGG + Intronic
907087828 1:51693262-51693284 CTTAGGAGGCTGAAGCAGGAGGG + Intronic
907309421 1:53530760-53530782 CTTTGAAGGCTGAGGGAGGTTGG - Intronic
910792941 1:91069876-91069898 CTTGAAAGGCTGAAGGTGGGAGG - Intergenic
910970140 1:92847977-92847999 CTTGAGAGGCTGAGGCAGGTGGG - Intronic
914213942 1:145607816-145607838 TTTCTGAGGCTGAAGGAGGTAGG - Intergenic
914465887 1:147928219-147928241 TTTCTGAGGCTGAAGGAGGTAGG - Intergenic
916059976 1:161091704-161091726 ATGGATAGGCTGAAGGAGATTGG - Intergenic
918120289 1:181532163-181532185 CTTAATTGGCTAAATGATGTGGG - Intronic
918841007 1:189539638-189539660 TTTAAGAGGCTGAGGTAGGTGGG + Intergenic
920554391 1:206894077-206894099 TTTAAGAGGTTGAAGGAAGTGGG - Intergenic
920957836 1:210635389-210635411 CTTAGTAGGCTGAGAGAGGCAGG + Intronic
924331032 1:242940697-242940719 CTTAGCAGGCTTAAAGAGGTTGG - Intergenic
924769305 1:247064914-247064936 CTTGAGAGGCTGAGGGAGGCAGG - Intronic
1063518159 10:6716748-6716770 GTAAAGATGCTGAAGGAGGTAGG + Intergenic
1064810967 10:19197637-19197659 GGTAAATGGCTGAAGGAGGTAGG - Intronic
1065138456 10:22696694-22696716 CTGAATAGGCTTTAGGAAGTAGG - Intronic
1070268482 10:74927792-74927814 CTTCCTAGGCTGGAGGAGATAGG - Intronic
1070531766 10:77343149-77343171 CTCAAGAGACTGAAGGGGGTCGG + Intronic
1071325800 10:84515821-84515843 TTTAATACGCTGTAGAAGGTAGG + Exonic
1072478382 10:95785614-95785636 CTCATTTGGCTGAAGGAAGTTGG + Intronic
1072649223 10:97280877-97280899 CTTAAAAGTCTGTAGGAGGCTGG - Intronic
1078399509 11:11011517-11011539 CCTAATTGGCTGACGGAGGAGGG + Intergenic
1080225581 11:29956586-29956608 ATTAATAGGCTCAAGCAGATTGG - Intergenic
1081420689 11:42872876-42872898 AATAAGAGGCTGAAAGAGGTTGG - Intergenic
1083904188 11:65659603-65659625 CTGAATAGGAGGAAGGGGGTTGG - Intronic
1084124877 11:67092807-67092829 CTCAAGAGGCTGAAGCAGGCTGG - Intergenic
1084921869 11:72477466-72477488 CTGAAGAGGCTGAAGGAGGGCGG + Intergenic
1086920041 11:92575804-92575826 GTTAATAGGCAGAAGGAGGAAGG + Intronic
1086945027 11:92836385-92836407 ATTAATCAGCTGAAGGAGGGTGG - Intronic
1087543422 11:99550470-99550492 CTTGAAAGGCTGAATAAGGTTGG - Intronic
1087953595 11:104256251-104256273 TTTAAATGGCTAAAGGAGGTTGG + Intergenic
1088647851 11:111931225-111931247 CTCAGGAGGCTGAATGAGGTGGG + Intronic
1088681557 11:112247750-112247772 CTTAACTGGCTGAAGGATGTGGG - Intronic
1090382572 11:126337431-126337453 GTTAGGAGGCTGCAGGAGGTTGG - Intronic
1090870473 11:130741549-130741571 CTTAATATGCTCAAGAAGGAGGG - Intergenic
1090905490 11:131070938-131070960 CTTAATAAGGGGAAGGAGGTAGG - Intergenic
1090941838 11:131393870-131393892 CTTAATAGGCTGAAGGAGGTAGG - Intronic
1092417090 12:8298521-8298543 CTCAACAGGCTGAAGCAGGAGGG - Intergenic
1093679602 12:21986641-21986663 TTAAATAGGTGGAAGGAGGTTGG - Intergenic
1094465418 12:30749072-30749094 AATAAAAGGCTGAAGGAGGTTGG + Intronic
1094465812 12:30753601-30753623 CAGATGAGGCTGAAGGAGGTGGG + Exonic
1096103669 12:48984286-48984308 GTTAATAGGCTGCCAGAGGTGGG + Intergenic
1096849766 12:54428102-54428124 CTGGACAGGCTGGAGGAGGTTGG + Intergenic
1096972210 12:55676134-55676156 CTCAAGAGGCTGAAGCAGGAAGG + Intergenic
1101946625 12:109142139-109142161 CTTGAGAGGCTGAAGCAGGAGGG + Intronic
1102325187 12:111975254-111975276 CTCAAGAGGCTGACTGAGGTGGG - Intronic
1102527248 12:113520678-113520700 CGTAATATCCTGACGGAGGTTGG - Intergenic
1102565543 12:113794991-113795013 CTGAATAGGGGGAAGGAGGGAGG + Intergenic
1102607016 12:114075670-114075692 CTTAAAAGGCTGAAGGTGCAGGG - Intergenic
1103013803 12:117478540-117478562 CTTCATAGGCTGAAGATGGGAGG - Intronic
1105863165 13:24434949-24434971 CACAATAGGGTGAAGAAGGTGGG + Exonic
1107045185 13:35986005-35986027 CTTAAAAGGCCGATGAAGGTCGG + Intronic
1108729038 13:53213823-53213845 CGTCATAGGCAGAAGGAGGAAGG - Intergenic
1109325041 13:60857417-60857439 CTTCCTAGGCTAAAAGAGGTAGG + Intergenic
1109789505 13:67228908-67228930 CTGAAAAGACTGAGGGAGGTAGG - Intronic
1110027832 13:70564606-70564628 GTTATTAGGCTTAAGGAAGTGGG - Intergenic
1111459414 13:88519977-88519999 CTTAAAAGGGTGAAGGTGGCCGG + Intergenic
1112086510 13:96037738-96037760 TTGAATAGGTTGAAGGAGCTGGG - Intronic
1118443025 14:65828973-65828995 CTTAATAGGCTAAAGCTGGTTGG + Intergenic
1119570466 14:75666596-75666618 CGTAATGGGCTGAAGGAGCTGGG + Intronic
1120385325 14:83838646-83838668 CTTAATTGTCTGATGGGGGTGGG - Intergenic
1120718789 14:87868401-87868423 ATAAAGAGGCTGAAGGAGGCAGG - Intronic
1122309119 14:100783499-100783521 CTTGAAAGACTCAAGGAGGTGGG + Intergenic
1127134861 15:55909626-55909648 CTTTGTAGGCTGAAGGGGCTTGG - Intronic
1127803915 15:62501134-62501156 CTCAGAAGGCTGAAGGAGCTTGG + Intronic
1127858869 15:62976445-62976467 ATTAACAGGCTCATGGAGGTGGG + Intergenic
1127869902 15:63063107-63063129 CTTTATATCCTGAAGGAGGAGGG + Intronic
1130725267 15:86432713-86432735 GATAAAAGCCTGAAGGAGGTAGG + Intronic
1130981238 15:88813045-88813067 CTTAATATGCTGATGGACCTTGG + Intronic
1131237119 15:90706299-90706321 CTTAAATGGCTGAAGGCGGGGGG - Intergenic
1131802921 15:96090255-96090277 GATAGTAGGCTGAAAGAGGTTGG - Intergenic
1131994901 15:98124378-98124400 ATTATCAGGCTGAAGCAGGTTGG - Intergenic
1133717523 16:8464060-8464082 TTATATAGGCTGAAGGAGATGGG + Intergenic
1134368652 16:13603232-13603254 CATAAGGGGCTGAGGGAGGTAGG + Intergenic
1136712643 16:32252954-32252976 CTCCATGGGCTGGAGGAGGTGGG + Exonic
1136755272 16:32676475-32676497 CTCCATGGGCTGGAGGAGGTGGG - Exonic
1136812841 16:33193894-33193916 CTCCATGGGCTGGAGGAGGTGGG + Exonic
1136819317 16:33303974-33303996 CTCCATGGGCTGGAGGAGGTGGG + Intronic
1136825880 16:33360509-33360531 CTCCATGGGCTGGAGGAGGTGGG + Exonic
1136830946 16:33459280-33459302 CTCCATGGGCTGGAGGAGGTGGG + Intergenic
1137014034 16:35355434-35355456 CTAAATAGGCTGAAAGAAATAGG - Intergenic
1137376836 16:47958990-47959012 CTTGAGAGGCTGAAGTAGGAGGG - Intergenic
1202991418 16_KI270728v1_random:16864-16886 CTCCATGGGCTGGAGGAGGTGGG + Intergenic
1203057415 16_KI270728v1_random:936814-936836 CTCCATGGGCTGGAGGAGGTGGG - Intergenic
1148691388 17:49528929-49528951 GTTTATAGGATGAAGAAGGTGGG - Intergenic
1149578593 17:57731309-57731331 CTTAAAGTGCTGGAGGAGGTAGG - Intergenic
1156261844 18:35451733-35451755 TTAACTAGGCTAAAGGAGGTGGG + Intronic
1156507636 18:37608509-37608531 CTTCAGAGGCTGAGGGAGCTGGG + Intergenic
1157514270 18:48299696-48299718 ATGAAGAGGCTGAAGGAGGATGG + Intronic
1159057569 18:63481331-63481353 CTTAATGTGCTGAGGGAGTTTGG - Intronic
1160303439 18:77707048-77707070 CTTACTATGCTGAAGGATGAAGG - Intergenic
1165748201 19:38243442-38243464 CTCAGGAGGCTGAAGCAGGTAGG + Intergenic
1168387415 19:55976224-55976246 TTTAATAGCCTGAAGGATGATGG + Exonic
925083821 2:1091915-1091937 CTAAATAGGCTGAGGGAGCCTGG - Intronic
925700967 2:6637644-6637666 CTTCATATGTTGAAGGAAGTTGG - Intergenic
926045223 2:9704940-9704962 CTTAACAGCCTGAATGAGCTGGG - Intergenic
926290338 2:11524245-11524267 TTCAACAGTCTGAAGGAGGTGGG + Intergenic
926858435 2:17282348-17282370 CATAATGGGCTGAAAGAGCTAGG + Intergenic
927628627 2:24750911-24750933 CTTAAAAGGGGGAAGGAGGGGGG + Intronic
928762867 2:34605219-34605241 CTTAAGAGGCAGGAGGAGATGGG + Intergenic
932266421 2:70371027-70371049 TTTAGGAGGCTGAAGTAGGTGGG + Intergenic
932271798 2:70417275-70417297 CTTAATATTCTGAATGAGATGGG + Intergenic
934876232 2:97923512-97923534 CTTGAGAGGCTGAGGGAGGAGGG + Intronic
936438516 2:112529511-112529533 CTTAATAGGTTGAATATGGTAGG + Exonic
937413965 2:121699684-121699706 CTTGCAAGGCTGAGGGAGGTGGG - Intergenic
938562952 2:132490714-132490736 CTGAACAGGGTGAGGGAGGTAGG + Intronic
939047506 2:137267339-137267361 CTTCATAGGCCTAATGAGGTTGG + Intronic
939900025 2:147840838-147840860 CTAAATACTCTGCAGGAGGTTGG - Intergenic
941871425 2:170389798-170389820 CCTAATAGACTGAATGAGGATGG - Intronic
947611494 2:231527532-231527554 CTTAGGAGGCTGAGTGAGGTAGG + Intronic
948680575 2:239631563-239631585 GTTGATGGGCTGATGGAGGTAGG + Intergenic
1169127314 20:3138847-3138869 CTTTGTAGGCTGAAGGAAGCTGG - Intronic
1170491333 20:16878450-16878472 CTTCATTGGATGAAGGAGGGTGG - Intergenic
1172733566 20:37109074-37109096 CTCAAGAGGCTGAGGGAGGTAGG + Intronic
1174032400 20:47640462-47640484 CTCAATAGGCAGCAGGTGGTTGG - Intronic
1175923949 20:62462950-62462972 CCTAATAGGATGCAGGAGGTTGG + Intergenic
1176674051 21:9760642-9760664 CTTAGTAGGAGGAAGGAGGGGGG - Intergenic
1183456189 22:37924609-37924631 CTTCATGGGCAGCAGGAGGTGGG - Intronic
951196114 3:19825567-19825589 CTTAGTAGGCTGGGAGAGGTTGG - Intergenic
952069289 3:29614297-29614319 CGCAAAAGGCTGAAGGAGGGTGG + Intronic
952278281 3:31899049-31899071 CTTGATAGGCTGAGGCAGGGAGG - Intronic
952577648 3:34794406-34794428 CTCAGTTGGCAGAAGGAGGTGGG - Intergenic
954958720 3:54545927-54545949 CTTAATAGGTTTAAGCAGGTTGG + Intronic
956268284 3:67422972-67422994 TTTATTAGGCTGAAGAAGGTAGG + Intronic
960442998 3:117711947-117711969 CTTAAAAGTCAGAAAGAGGTAGG - Intergenic
960695912 3:120396145-120396167 CTTCATAGGTGGAAGGAGTTTGG - Exonic
961266772 3:125649318-125649340 CTTAGGAGGCTGAAGAAGGAGGG + Intergenic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
961542145 3:127607255-127607277 CTGAATATGGTGCAGGAGGTTGG - Intronic
964704974 3:159608575-159608597 CTTAACTGGCTGACTGAGGTTGG - Intronic
964917143 3:161852343-161852365 CTTAGTAAGCTTAAAGAGGTTGG + Intergenic
966002003 3:174960927-174960949 CTTAAGAGGCTGAAGCAGGAGGG + Intronic
968761473 4:2444514-2444536 CTTGATAGGCTGATGATGGTGGG + Intronic
969748134 4:9089944-9089966 CTCAAGAGGCTGAAGCAGGAGGG + Intergenic
970760466 4:19480259-19480281 GTTAATAGGCAGAAGGAGGGAGG - Intergenic
970905425 4:21210721-21210743 CTTCATGGGCTGAAGGTGGAAGG - Intronic
971417101 4:26441913-26441935 CTTATTAGGTTAAAGGAAGTGGG - Intergenic
972476336 4:39453346-39453368 CTAAGGAGGCTGAAGCAGGTAGG + Intergenic
977203413 4:94143106-94143128 CTTAATAGACTGAAGGTAATGGG + Intergenic
978483500 4:109223220-109223242 ATTAATAGGCTGAAATAGTTTGG - Intronic
978847545 4:113292111-113292133 CTTAAGAAGGTGAAGGGGGTGGG - Intronic
981971999 4:150674765-150674787 CTTGGGAGGCTGAAGGAGGAGGG + Intronic
984447358 4:179853649-179853671 CTTCAAAGGCAGAAGCAGGTAGG + Intergenic
987372217 5:17203748-17203770 GTTAAGAGGCTGATGAAGGTGGG - Intronic
987444636 5:18002460-18002482 CTGGATAGCCTGAAGGAGGAAGG + Intergenic
988692900 5:33590527-33590549 CTCATAAGGCTGAAGGAGGAAGG - Intronic
990466314 5:56074866-56074888 CTTAGGAGGCTGAGGGAGGAGGG + Intergenic
990802440 5:59620045-59620067 CTGAAAAGGCAGAAGCAGGTGGG + Intronic
990887532 5:60611726-60611748 CTATAAAGGCTGAGGGAGGTGGG + Intronic
993844815 5:92927915-92927937 GTTAATAGGCAGAAAGAGATTGG + Intergenic
995372831 5:111439082-111439104 CCTAAAAGAATGAAGGAGGTAGG - Intronic
996092228 5:119362551-119362573 TTTGAGAGGTTGAAGGAGGTGGG + Intronic
996298114 5:121948198-121948220 CTTAATAGACTGATAGAAGTAGG - Intergenic
996914380 5:128694699-128694721 TTAAATAGGATTAAGGAGGTTGG - Intronic
996974938 5:129420965-129420987 CTCAGGAGGCTGAAGCAGGTAGG - Intergenic
999161990 5:149509166-149509188 CTTGGTAGGCTGAAGGAGGGTGG - Intronic
999353209 5:150897610-150897632 CTGATGAGGCTGAAGGAGGAGGG - Intronic
1002556362 5:180044925-180044947 CTTAAGAGACTGAAGGAGGGAGG + Intronic
1004180754 6:13378774-13378796 GTTCCTAGGCTGCAGGAGGTGGG - Intronic
1004511555 6:16287981-16288003 AGTAATAGGATGAAGGAGGAGGG - Intronic
1004777066 6:18859540-18859562 TTAAATAGGGTGATGGAGGTAGG + Intergenic
1007301434 6:40870857-40870879 CTTATTATGGTGGAGGAGGTGGG + Intergenic
1007326176 6:41061692-41061714 CTGAAGAAGCTGAAGGAGGCTGG + Exonic
1007461422 6:42021932-42021954 CATAAAGGGCTGAAGGAGGCTGG + Intronic
1009636098 6:66266274-66266296 TTTAATACGCTGAAAGAGATGGG - Intergenic
1010778270 6:79911475-79911497 TTACAAAGGCTGAAGGAGGTGGG - Intergenic
1011172483 6:84521511-84521533 TTTAAAAGGCTGAAAGAGGGAGG + Intergenic
1015672164 6:135703047-135703069 GTTAGGAGGCTGCAGGAGGTTGG + Intergenic
1015829088 6:137348203-137348225 TTTGAGAGGCTGAAGCAGGTGGG + Intergenic
1016991884 6:149935791-149935813 CTTAATAGGAGGAAGGAGCAGGG - Intergenic
1016994426 6:149951680-149951702 CTTAATAGGATGAAGGAGTAGGG - Intergenic
1019843088 7:3468900-3468922 CTTCAGAGGGTGAAGGGGGTAGG + Intronic
1020340216 7:7101893-7101915 CTGAGTAGGCAGAGGGAGGTTGG - Intergenic
1021663630 7:22948778-22948800 CTAGATAGGCTGAAGAATGTTGG + Intronic
1021807387 7:24370869-24370891 ATTAATGAGCTGGAGGAGGTGGG + Intergenic
1022540689 7:31132999-31133021 CCAAATAGGATTAAGGAGGTTGG - Intergenic
1023574745 7:41615194-41615216 CATACTCTGCTGAAGGAGGTAGG - Intergenic
1024263497 7:47589106-47589128 CTTGGGAGGCTGAAGCAGGTGGG + Intergenic
1027770089 7:82395671-82395693 ATTAATAGTCTGAAGGAAGTTGG + Intronic
1028747613 7:94345959-94345981 CTTCATAGGCTGGAGGTGGGTGG - Intergenic
1032635297 7:133700702-133700724 TTTTATTAGCTGAAGGAGGTTGG + Intronic
1033274542 7:139961461-139961483 CATAATGAGCTGGAGGAGGTGGG - Intronic
1033321999 7:140348181-140348203 CTTATTAGGCTGGGGAAGGTGGG + Intronic
1033334850 7:140443905-140443927 CTAAATAGGGAGGAGGAGGTGGG + Intergenic
1033430403 7:141283993-141284015 ATGATTCGGCTGAAGGAGGTCGG - Intronic
1033561495 7:142536351-142536373 TGTAATAGGGAGAAGGAGGTGGG + Intergenic
1034354015 7:150436476-150436498 CTAAAGATGTTGAAGGAGGTGGG + Intergenic
1035998858 8:4579468-4579490 CTTAAGAGGCTAAGGGAGGCAGG - Intronic
1037925676 8:22842429-22842451 CTTGTGGGGCTGAAGGAGGTAGG + Intronic
1041062498 8:54049286-54049308 CTTGATAGAATGAAGGAGGCCGG - Intronic
1042723434 8:71847906-71847928 CTTAATATGCTGTTGGAGGAAGG - Intronic
1043800240 8:84600514-84600536 GTTAATAGGTAAAAGGAGGTTGG + Intronic
1045035011 8:98170072-98170094 CTTTATAGAGGGAAGGAGGTCGG + Intergenic
1045051926 8:98335257-98335279 CTTTAGAGGCAGAATGAGGTTGG - Intergenic
1046526190 8:115384945-115384967 TTTAAAAGGAAGAAGGAGGTGGG + Intergenic
1046730736 8:117723273-117723295 GTGAATAGGATGAAGGAGGGAGG - Intergenic
1046889196 8:119402494-119402516 CTCAAGAGGGTGAATGAGGTTGG - Intergenic
1047229107 8:122980857-122980879 CTTAGTGTGCTGGAGGAGGTTGG - Intergenic
1047298264 8:123590041-123590063 CTTACTAGGCTGAAGTAGGCTGG + Intergenic
1051483255 9:17581286-17581308 CTTAAAAGGTTGGAGAAGGTCGG + Intronic
1055107019 9:72523611-72523633 TTGAATAGGCTGAAGGAGGAGGG + Intronic
1058810369 9:108633270-108633292 CTTGAGAGGCTGAAGCAGGAAGG + Intergenic
1185571624 X:1139009-1139031 TTTAATAGGTTGAAAGAGGCAGG - Intergenic
1187200343 X:17128388-17128410 CATTATAGGCTGCTGGAGGTGGG + Intronic
1188332280 X:28889606-28889628 CTTAATAAGTTGAAAGATGTTGG - Intronic
1188621240 X:32226725-32226747 CTGAAAAAGCTGAATGAGGTAGG - Intronic
1188994927 X:36872472-36872494 CTTAAGAGGCTGAAGCAGGAGGG + Intergenic
1189499325 X:41540617-41540639 CTTAATAGGCAGCTGGAGATAGG - Intronic
1189966471 X:46378744-46378766 CTGAATAGGTTGCAGGGGGTTGG - Intergenic
1190074876 X:47309657-47309679 CTCAAGAGGCTGAAGAAGGAGGG - Intergenic
1191901590 X:66046307-66046329 CCTCATAGGGTGAAGAAGGTAGG + Intergenic
1192999117 X:76544503-76544525 GTTGATAGGCTTAAGGAGATAGG + Intergenic
1193864471 X:86713722-86713744 CTTAATAGGCTGAAATTTGTAGG - Intronic
1193920801 X:87423727-87423749 CTTAATAGGAAAAAGGAAGTGGG - Intergenic
1194189070 X:90812170-90812192 ATTAATAGGCTGAGTAAGGTGGG + Intergenic
1195014134 X:100761870-100761892 CTTGAGAGGCTTAAGGAGATTGG - Intergenic
1195376348 X:104231612-104231634 CTTAAGAGGCTGAGGTAGGAGGG - Intergenic
1198803597 X:140472104-140472126 CTTGAGAGGCTGAAGCAGGAGGG - Intergenic
1199369746 X:147033647-147033669 CTCAAGAGGCTGAAGGGGGGAGG + Intergenic
1199761637 X:150908961-150908983 CTTAAGAGGCTGAGGCAGGAGGG + Intergenic