ID: 1090943467

View in Genome Browser
Species Human (GRCh38)
Location 11:131409337-131409359
Sequence ACACCTCTTTGTAGCCCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 113}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090943467_1090943472 -5 Left 1090943467 11:131409337-131409359 CCATCTGGGCTACAAAGAGGTGT 0: 1
1: 0
2: 1
3: 7
4: 113
Right 1090943472 11:131409355-131409377 GGTGTTGGAGGGAGGAAACCTGG 0: 1
1: 0
2: 4
3: 28
4: 394
1090943467_1090943473 6 Left 1090943467 11:131409337-131409359 CCATCTGGGCTACAAAGAGGTGT 0: 1
1: 0
2: 1
3: 7
4: 113
Right 1090943473 11:131409366-131409388 GAGGAAACCTGGAGAAGCTTAGG 0: 1
1: 1
2: 1
3: 29
4: 270
1090943467_1090943475 19 Left 1090943467 11:131409337-131409359 CCATCTGGGCTACAAAGAGGTGT 0: 1
1: 0
2: 1
3: 7
4: 113
Right 1090943475 11:131409379-131409401 GAAGCTTAGGCACAGCCTTCTGG 0: 1
1: 0
2: 1
3: 17
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090943467 Original CRISPR ACACCTCTTTGTAGCCCAGA TGG (reversed) Intronic