ID: 1090943472

View in Genome Browser
Species Human (GRCh38)
Location 11:131409355-131409377
Sequence GGTGTTGGAGGGAGGAAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 427
Summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 394}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090943466_1090943472 -4 Left 1090943466 11:131409336-131409358 CCCATCTGGGCTACAAAGAGGTG 0: 1
1: 0
2: 0
3: 7
4: 183
Right 1090943472 11:131409355-131409377 GGTGTTGGAGGGAGGAAACCTGG 0: 1
1: 0
2: 4
3: 28
4: 394
1090943465_1090943472 -3 Left 1090943465 11:131409335-131409357 CCCCATCTGGGCTACAAAGAGGT 0: 1
1: 0
2: 1
3: 9
4: 116
Right 1090943472 11:131409355-131409377 GGTGTTGGAGGGAGGAAACCTGG 0: 1
1: 0
2: 4
3: 28
4: 394
1090943463_1090943472 -2 Left 1090943463 11:131409334-131409356 CCCCCATCTGGGCTACAAAGAGG 0: 1
1: 0
2: 0
3: 16
4: 127
Right 1090943472 11:131409355-131409377 GGTGTTGGAGGGAGGAAACCTGG 0: 1
1: 0
2: 4
3: 28
4: 394
1090943462_1090943472 6 Left 1090943462 11:131409326-131409348 CCTGAGAGCCCCCATCTGGGCTA 0: 1
1: 0
2: 2
3: 8
4: 127
Right 1090943472 11:131409355-131409377 GGTGTTGGAGGGAGGAAACCTGG 0: 1
1: 0
2: 4
3: 28
4: 394
1090943460_1090943472 8 Left 1090943460 11:131409324-131409346 CCCCTGAGAGCCCCCATCTGGGC 0: 1
1: 0
2: 2
3: 22
4: 270
Right 1090943472 11:131409355-131409377 GGTGTTGGAGGGAGGAAACCTGG 0: 1
1: 0
2: 4
3: 28
4: 394
1090943467_1090943472 -5 Left 1090943467 11:131409337-131409359 CCATCTGGGCTACAAAGAGGTGT 0: 1
1: 0
2: 1
3: 7
4: 113
Right 1090943472 11:131409355-131409377 GGTGTTGGAGGGAGGAAACCTGG 0: 1
1: 0
2: 4
3: 28
4: 394
1090943461_1090943472 7 Left 1090943461 11:131409325-131409347 CCCTGAGAGCCCCCATCTGGGCT 0: 1
1: 0
2: 7
3: 46
4: 331
Right 1090943472 11:131409355-131409377 GGTGTTGGAGGGAGGAAACCTGG 0: 1
1: 0
2: 4
3: 28
4: 394
1090943457_1090943472 22 Left 1090943457 11:131409310-131409332 CCTCATTGAAGCTGCCCCTGAGA 0: 1
1: 0
2: 1
3: 14
4: 154
Right 1090943472 11:131409355-131409377 GGTGTTGGAGGGAGGAAACCTGG 0: 1
1: 0
2: 4
3: 28
4: 394

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090943472 Original CRISPR GGTGTTGGAGGGAGGAAACC TGG Intronic