ID: 1090943475

View in Genome Browser
Species Human (GRCh38)
Location 11:131409379-131409401
Sequence GAAGCTTAGGCACAGCCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 124}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090943462_1090943475 30 Left 1090943462 11:131409326-131409348 CCTGAGAGCCCCCATCTGGGCTA 0: 1
1: 0
2: 2
3: 8
4: 127
Right 1090943475 11:131409379-131409401 GAAGCTTAGGCACAGCCTTCTGG 0: 1
1: 0
2: 1
3: 17
4: 124
1090943465_1090943475 21 Left 1090943465 11:131409335-131409357 CCCCATCTGGGCTACAAAGAGGT 0: 1
1: 0
2: 1
3: 9
4: 116
Right 1090943475 11:131409379-131409401 GAAGCTTAGGCACAGCCTTCTGG 0: 1
1: 0
2: 1
3: 17
4: 124
1090943463_1090943475 22 Left 1090943463 11:131409334-131409356 CCCCCATCTGGGCTACAAAGAGG 0: 1
1: 0
2: 0
3: 16
4: 127
Right 1090943475 11:131409379-131409401 GAAGCTTAGGCACAGCCTTCTGG 0: 1
1: 0
2: 1
3: 17
4: 124
1090943467_1090943475 19 Left 1090943467 11:131409337-131409359 CCATCTGGGCTACAAAGAGGTGT 0: 1
1: 0
2: 1
3: 7
4: 113
Right 1090943475 11:131409379-131409401 GAAGCTTAGGCACAGCCTTCTGG 0: 1
1: 0
2: 1
3: 17
4: 124
1090943466_1090943475 20 Left 1090943466 11:131409336-131409358 CCCATCTGGGCTACAAAGAGGTG 0: 1
1: 0
2: 0
3: 7
4: 183
Right 1090943475 11:131409379-131409401 GAAGCTTAGGCACAGCCTTCTGG 0: 1
1: 0
2: 1
3: 17
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090943475 Original CRISPR GAAGCTTAGGCACAGCCTTC TGG Intronic