ID: 1090947508

View in Genome Browser
Species Human (GRCh38)
Location 11:131444658-131444680
Sequence CCCCACAACCACACTTCTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 119}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090947508_1090947513 -1 Left 1090947508 11:131444658-131444680 CCTTAAGAAGTGTGGTTGTGGGG 0: 1
1: 0
2: 1
3: 9
4: 119
Right 1090947513 11:131444680-131444702 GGGTGTGGCACAGAACATTTAGG 0: 1
1: 0
2: 0
3: 8
4: 110
1090947508_1090947514 4 Left 1090947508 11:131444658-131444680 CCTTAAGAAGTGTGGTTGTGGGG 0: 1
1: 0
2: 1
3: 9
4: 119
Right 1090947514 11:131444685-131444707 TGGCACAGAACATTTAGGTTAGG 0: 1
1: 0
2: 0
3: 11
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090947508 Original CRISPR CCCCACAACCACACTTCTTA AGG (reversed) Intronic
900583142 1:3419152-3419174 CCCCACACCCCCACTTCTGGTGG + Intronic
901232464 1:7648862-7648884 CCCCAGGACCATACTTTTTAAGG + Intronic
901629921 1:10643020-10643042 CCCCACAGCCCCACTTCCTCAGG - Intronic
903557880 1:24206445-24206467 ACCCACAACCACTTCTCTTATGG - Intergenic
903953484 1:27010000-27010022 CCCCACAACCACTCTGCTCCAGG + Intronic
908161323 1:61411309-61411331 CCCCACTTCCCTACTTCTTAGGG - Intronic
911705657 1:101009391-101009413 CTCCACTACCACAGTTATTATGG - Intronic
915138185 1:153748798-153748820 TCCCACACCCACACTCCTAATGG - Intronic
916241551 1:162644890-162644912 CCAGCCAACCACACTTCTTAAGG + Intronic
916268623 1:162917676-162917698 CCCCACCACCCCACTTGTCAGGG - Intergenic
918923430 1:190746513-190746535 ACACACACACACACTTCTTATGG + Intergenic
920922827 1:210312232-210312254 ACCCACACCCACACTCCTCACGG + Intergenic
1064992271 10:21266538-21266560 CCCCACACCCACACTGCATGAGG + Intergenic
1068909728 10:62366686-62366708 TCCCACAACCACTTTGCTTAGGG + Intergenic
1072699718 10:97632046-97632068 CCCCAGAACCACCCTTCCCAGGG + Intronic
1075532477 10:123241383-123241405 CACCACTATCACAGTTCTTATGG - Intergenic
1076271703 10:129158272-129158294 CCCCACATCCCCACATCTGAAGG + Intergenic
1081110699 11:39129953-39129975 ACCCACTGCCACACTTCTTTAGG - Intergenic
1082011748 11:47454415-47454437 CTCTACAACCACACTGCTTCTGG - Intergenic
1085281454 11:75333794-75333816 CCCCACAGCCACCTGTCTTAGGG + Intronic
1087129861 11:94659361-94659383 CCCCAAAAGGACACTTCTTGGGG + Intergenic
1089809298 11:121118497-121118519 CCACACTACCACACTTTTGACGG + Exonic
1090275153 11:125413809-125413831 ACCTACAACCTCACTTCTGAAGG + Intronic
1090633453 11:128670755-128670777 CCTGATAACCACACGTCTTAGGG + Intergenic
1090761213 11:129838254-129838276 CCCCACAACCAAGCCTCTTGTGG - Intronic
1090947508 11:131444658-131444680 CCCCACAACCACACTTCTTAAGG - Intronic
1092060809 12:5548896-5548918 CCCCAGACCCACACTTGCTACGG + Intronic
1095121340 12:38423624-38423646 ACCCACTGCCACACTTCTTTAGG + Intergenic
1098305244 12:69096113-69096135 TTCCACATCCACTCTTCTTAAGG + Intergenic
1098946507 12:76595099-76595121 CTACACAACCACCCTACTTAAGG - Intergenic
1106002608 13:25738346-25738368 CCCCCCACACACACTTCTTCTGG + Intronic
1106048527 13:26168448-26168470 CCCAAAAACGACACTTCATATGG - Intronic
1106072236 13:26424076-26424098 CCCCCCGCCCACAATTCTTAAGG + Intergenic
1106537327 13:30658661-30658683 CAACTCAACCACAGTTCTTATGG + Exonic
1106575144 13:30967582-30967604 CCCTACAAACACTCTTCTCAGGG + Intronic
1107560318 13:41551996-41552018 CCCCACACCCAGACTCCTCAGGG + Intergenic
1113597802 13:111547025-111547047 CCCCACATCCACACTTCCTGTGG - Intergenic
1119390768 14:74289697-74289719 CCCCCTAAACACACTTCTGAAGG - Intronic
1119571158 14:75673973-75673995 CCCCCCAAACATACTTCTTTTGG + Intronic
1127291750 15:57577715-57577737 CCCCACACTCATAGTTCTTATGG - Intergenic
1127371136 15:58342735-58342757 CCCCAGAAGCACTGTTCTTAAGG + Intronic
1127791609 15:62403530-62403552 TCCCAGAACCACACTTATTAAGG + Intronic
1133321996 16:4919942-4919964 CCCCACAAATACACTTTTTTTGG - Intronic
1134383649 16:13751459-13751481 CCACACAACCACACTGGTTGGGG + Intergenic
1134393622 16:13842519-13842541 CCCCAGAGCCAGACTTCTTAGGG + Intergenic
1135061470 16:19274751-19274773 GCCCACTGCCACACTTCTTTGGG + Intergenic
1136416739 16:30108701-30108723 CCCCACCACCACTCTGCTTTGGG - Intronic
1137295913 16:47093214-47093236 TCCCTCTACCACACTTCTTGTGG + Intronic
1141728347 16:85805635-85805657 CCCCAAAACCACACTTGTGAAGG - Intronic
1143484653 17:7247048-7247070 CCCCACCACCACACACCTTGAGG + Exonic
1143750664 17:9024542-9024564 CCCCACAAACACACGTTTTGAGG + Intronic
1144341335 17:14312730-14312752 CCCCACAACTACACCACTCAGGG + Intronic
1145301916 17:21646744-21646766 CCCCACAACCACATACCTTGGGG - Intergenic
1145695048 17:26780838-26780860 CCCCACAACCACCTATCTTGGGG - Intergenic
1146381422 17:32331873-32331895 CTCCACTACCACAGTTCTTTAGG + Exonic
1146692320 17:34884925-34884947 CCTCACATCCACAGTTTTTATGG + Intergenic
1147402162 17:40187315-40187337 CCCCACCACCACAACCCTTAGGG + Intronic
1148633378 17:49129152-49129174 CCCCACCACCCCACTTCTTGTGG - Intergenic
1149120644 17:53159763-53159785 ACCGCAAACCACACTTCTTAGGG - Intergenic
1149562042 17:57615001-57615023 CACCACCACCACACTCCTGAGGG - Intronic
1151328294 17:73392053-73392075 CCCCACATCCACCCTCCTGAGGG + Intronic
1203192863 17_KI270729v1_random:205676-205698 CCCCACAACCACATACCTTGGGG - Intergenic
1203202227 17_KI270730v1_random:5111-5133 CCCCACAACCACATACCTTGGGG - Intergenic
1156487826 18:37477795-37477817 TCCCACAACCAAACTTCGCAGGG + Intronic
1156962124 18:43044852-43044874 CCCCACAAACTCACTGCTAATGG + Intronic
1158461462 18:57649607-57649629 CCTCACAGCCACATTTCTCATGG + Intronic
1160061868 18:75536316-75536338 CCCCCCAACAACACTTGGTATGG + Intergenic
1167437876 19:49490408-49490430 CCCCAAAACCCCACTTCCAAGGG - Intronic
926383939 2:12317507-12317529 CCTCACACCCACACTGCTTCTGG - Intergenic
926458968 2:13103729-13103751 CCCAACAACCAAACTGCTTCCGG + Intergenic
928452007 2:31385854-31385876 CCCCACCACCCCACTTTTTCTGG - Intronic
934655537 2:96115279-96115301 CCCCACAAACACCCTCCTTCTGG + Exonic
939913745 2:148015089-148015111 CCCCACAACCACACTTGACTAGG + Intronic
942487054 2:176451047-176451069 CCTCACAACAACACTTCTGTTGG + Intergenic
945074901 2:206028829-206028851 CCCTACAACCAAATTTCTTTAGG - Intronic
946648404 2:221865359-221865381 ACCTACAACCACAGTTCTTTGGG + Intergenic
946788801 2:223277270-223277292 CCCAAATACCACATTTCTTAGGG + Intergenic
1170307393 20:14953649-14953671 CACCACAACTACACATCTGATGG - Intronic
1171210539 20:23313226-23313248 CCCCACCACCAAACATCTTTTGG + Intergenic
1171518499 20:25758138-25758160 CCCCACAACCACATACCTTTGGG - Intergenic
1176924183 21:14726817-14726839 CCCCACAACCACACGCTTCATGG - Intergenic
1178823826 21:35998664-35998686 CCCCACAACCACACATGTTAGGG + Intronic
1183237849 22:36633053-36633075 CCTCACTACCTCACTTCTTCAGG + Intronic
952964596 3:38613338-38613360 TCCCACAAACACACTTCTTTTGG + Intronic
962802152 3:138899540-138899562 CTCTCCAACCACGCTTCTTAGGG + Intergenic
963931630 3:151009738-151009760 CCCCACCACCCCACTTCCTTTGG + Intergenic
964045237 3:152315919-152315941 GCACACACCCACACGTCTTATGG + Intronic
965427263 3:168542521-168542543 CACCACAAACACACTTATTTAGG + Intergenic
966505223 3:180693079-180693101 CCTAACAACCACACTCCTTAAGG + Intronic
968917384 4:3502501-3502523 CCCCACATCCACACTTCGTGTGG - Intergenic
973304599 4:48631481-48631503 CACCACAGCAATACTTCTTAAGG + Intronic
981417008 4:144505167-144505189 TCCCTCAACCAAATTTCTTAAGG - Intergenic
982403780 4:154998351-154998373 CCCTACAACCACATTACTAAAGG - Intergenic
985791431 5:1930608-1930630 CCCCAAAACCCCACTCCTCACGG - Intergenic
986410480 5:7474515-7474537 TGCCACAACCACAACTCTTAAGG - Intronic
989643672 5:43606199-43606221 CCCAACAACCACCATTTTTATGG - Intronic
990960202 5:61385942-61385964 CCCAATAGCCACACTTCTTGAGG + Intronic
1000881561 5:166703706-166703728 CCCCACAACCATCCTGCCTAAGG - Intergenic
1001545493 5:172568269-172568291 CCCCCCCACCCCACTTCTGAAGG - Intergenic
1005817825 6:29570691-29570713 CCCCACCACCATCCTTCTTCTGG - Intronic
1008940347 6:57039808-57039830 CCCCACCCCCACACTTTTTCTGG - Intergenic
1010184185 6:73123775-73123797 CTCCAAATCCCCACTTCTTAAGG - Intronic
1014305383 6:119735084-119735106 CCCCACAGTCACAGTACTTAAGG + Intergenic
1015010430 6:128339888-128339910 TCCCACAACCAAGTTTCTTAGGG + Intronic
1016306894 6:142694211-142694233 CCCCACCCCCACAATTCTTGTGG + Intergenic
1016822609 6:148360820-148360842 ACCCACAACCACACCTCACAGGG - Intronic
1017031257 6:150224871-150224893 CCTTACTACCACACTACTTAAGG - Intronic
1018543256 6:164907207-164907229 ACCCACATCCAGACTTCTTGGGG - Intergenic
1022832154 7:34078886-34078908 CCCCACTACAACACTTTTGACGG + Exonic
1024000792 7:45188177-45188199 CCGCACAACCACTCTTCAGATGG - Intergenic
1027427858 7:78080295-78080317 CCCCAAATCCATACTTCTAAAGG - Intronic
1028871044 7:95772267-95772289 CCAGGCAACTACACTTCTTAAGG - Intergenic
1033143286 7:138847227-138847249 CCACACCACAACACTTCTGAGGG + Intronic
1034901504 7:154910527-154910549 CCCCACACCCACATTCCTTTTGG + Intergenic
1034972451 7:155427688-155427710 CCCCCCAGCCACACTCCCTACGG + Intergenic
1038236584 8:25763904-25763926 CTCCACAACCACAAATTTTAAGG - Intergenic
1047576503 8:126161463-126161485 TCCCACAATCACATTTCATAAGG - Intergenic
1053382176 9:37658096-37658118 CCCCACATCTTCACTTCTTTAGG + Intronic
1055677755 9:78682652-78682674 CCTCACCACCACACATGTTAAGG - Intergenic
1058947777 9:109875110-109875132 CACCCCAACCTCACTTATTATGG + Intronic
1061430690 9:130528540-130528562 CCCCACCACCCCACAGCTTACGG + Intergenic
1061846001 9:133388768-133388790 CCCCCCAAACACAGTTCTCAGGG - Intronic
1186725911 X:12358572-12358594 CCCCAAAATCTCAGTTCTTAAGG + Intronic
1188856639 X:35204472-35204494 CCCCTAAACCAAACTTATTATGG - Intergenic
1192328790 X:70157255-70157277 CCCCACCCCCACCCTTGTTAAGG - Intronic
1193222954 X:78948291-78948313 TGCTACAACTACACTTCTTAGGG + Intronic
1196102071 X:111856871-111856893 ACACACACACACACTTCTTATGG - Intronic
1198861530 X:141075874-141075896 CTCAACAACCAAATTTCTTATGG - Intergenic
1198901161 X:141511509-141511531 CTCAACAACCAAATTTCTTATGG + Intergenic
1199486922 X:148358403-148358425 CCCCAAAACTACACTTGTCAAGG + Intergenic