ID: 1090951513

View in Genome Browser
Species Human (GRCh38)
Location 11:131477466-131477488
Sequence GTGGCTGACCACTGAGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 153}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090951506_1090951513 17 Left 1090951506 11:131477426-131477448 CCAGAGCATCTAATATGAACCAG 0: 1
1: 0
2: 1
3: 29
4: 195
Right 1090951513 11:131477466-131477488 GTGGCTGACCACTGAGTGGGAGG 0: 1
1: 0
2: 0
3: 11
4: 153
1090951505_1090951513 30 Left 1090951505 11:131477413-131477435 CCATTCTCGGTGGCCAGAGCATC 0: 1
1: 0
2: 1
3: 4
4: 116
Right 1090951513 11:131477466-131477488 GTGGCTGACCACTGAGTGGGAGG 0: 1
1: 0
2: 0
3: 11
4: 153
1090951510_1090951513 -8 Left 1090951510 11:131477451-131477473 CCTCTTCTAGTGAATGTGGCTGA 0: 1
1: 0
2: 1
3: 9
4: 135
Right 1090951513 11:131477466-131477488 GTGGCTGACCACTGAGTGGGAGG 0: 1
1: 0
2: 0
3: 11
4: 153
1090951508_1090951513 -2 Left 1090951508 11:131477445-131477467 CCAGGTCCTCTTCTAGTGAATGT 0: 1
1: 0
2: 0
3: 9
4: 112
Right 1090951513 11:131477466-131477488 GTGGCTGACCACTGAGTGGGAGG 0: 1
1: 0
2: 0
3: 11
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090951513 Original CRISPR GTGGCTGACCACTGAGTGGG AGG Intronic