ID: 1090953434

View in Genome Browser
Species Human (GRCh38)
Location 11:131494501-131494523
Sequence CCAATTGAACCCATTTGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 123}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090953428_1090953434 8 Left 1090953428 11:131494470-131494492 CCAGGCAAATACAACTTCCATGT 0: 1
1: 0
2: 3
3: 19
4: 154
Right 1090953434 11:131494501-131494523 CCAATTGAACCCATTTGCTGGGG 0: 1
1: 0
2: 0
3: 11
4: 123
1090953430_1090953434 -9 Left 1090953430 11:131494487-131494509 CCATGTTATGGTAACCAATTGAA 0: 1
1: 0
2: 1
3: 6
4: 102
Right 1090953434 11:131494501-131494523 CCAATTGAACCCATTTGCTGGGG 0: 1
1: 0
2: 0
3: 11
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090953434 Original CRISPR CCAATTGAACCCATTTGCTG GGG Intronic
904190396 1:28738402-28738424 CCAATAAATCCCATTTTCTGAGG + Intronic
909329721 1:74396674-74396696 GTATTTGAACCCATTTCCTGGGG - Intronic
911534508 1:99084185-99084207 TCAATGGATCCCATTTTCTGAGG + Intergenic
913666099 1:121050238-121050260 CCAACTGCACCCAGTAGCTGTGG + Intergenic
913668305 1:121070818-121070840 CCAATTTCTCCCATTTGCAGTGG - Intergenic
913945302 1:125156607-125156629 CCATTTGAAACCATTTGATGGGG + Intergenic
913954555 1:143276244-143276266 CCAATTGATTCCATTAGATGAGG - Intergenic
914017499 1:143833514-143833536 CCAACTGCACCCAGTAGCTGTGG + Intergenic
914020046 1:143858261-143858283 CCAATTTCTCCCATTTGCAGTGG - Intergenic
914656110 1:149742046-149742068 CCAACTGCACCCAGTAGCTGTGG + Intergenic
915202899 1:154246103-154246125 CAAAATGAAGCCACTTGCTGGGG - Intronic
920937837 1:210452304-210452326 CCAATTGAATGCATGTGCAGGGG - Intronic
922650902 1:227337449-227337471 CCAACTGAATACATTTTCTGAGG - Intergenic
922686525 1:227642914-227642936 CCAATTGCCTCCATTTGATGTGG + Intronic
923673841 1:236064252-236064274 CCCAGTGATCCCATTTCCTGTGG - Intronic
1066088438 10:31994086-31994108 CCACTTGAGCCCAGTTGCTCTGG - Intergenic
1068912122 10:62389464-62389486 ATAATAGAGCCCATTTGCTGCGG - Intronic
1071245289 10:83754769-83754791 CCCCTTGAACCCATTTGCCCTGG + Intergenic
1072294458 10:93995495-93995517 CCTACTGAAGGCATTTGCTGTGG + Intronic
1074058398 10:109943007-109943029 CCAATTAAACCTCTTTTCTGAGG - Intronic
1075530997 10:123229755-123229777 CCTAAGGAACCCATTGGCTGTGG + Intergenic
1076181491 10:128412468-128412490 CTAACTGACCACATTTGCTGAGG - Intergenic
1083361775 11:62113802-62113824 TCAATTGAAGTCATATGCTGGGG - Intergenic
1085991433 11:81851513-81851535 CCAATTATACACATTGGCTGTGG - Intergenic
1088765158 11:112968071-112968093 CCACTTGGACCCACTTGCTTGGG + Intronic
1090342536 11:126037398-126037420 CCCATTCAACCCATTTTCTAAGG + Intronic
1090953434 11:131494501-131494523 CCAATTGAACCCATTTGCTGGGG + Intronic
1095833280 12:46610185-46610207 ACAATTGAACCATTTTGGTGAGG - Intergenic
1098130257 12:67342681-67342703 AAAATTGAACCCAAATGCTGGGG - Intergenic
1098469479 12:70826983-70827005 CCACTTGAAGCCATTTACAGTGG + Intronic
1100012995 12:89976238-89976260 ACAATTGTAACCATTTGTTGTGG + Intergenic
1104355953 12:128087324-128087346 GCATTTGAACCCTTTTCCTGGGG + Intergenic
1106436071 13:29723870-29723892 CTAATTTAAGCCATTTGCAGGGG + Intergenic
1110462319 13:75758841-75758863 CCAATTCAACCAATTTGATTTGG - Intronic
1111659137 13:91187569-91187591 ACAGCTGAAACCATTTGCTGGGG + Intergenic
1113533960 13:111049685-111049707 CCACATGGACCCTTTTGCTGTGG - Intergenic
1114180295 14:20361122-20361144 CCAATTGACCATATTTGCTTGGG - Intergenic
1115458617 14:33634308-33634330 CCAAAGGAACAGATTTGCTGTGG + Intronic
1116655040 14:47641856-47641878 TCAATTGAACTCATTTGATAGGG + Intronic
1125233268 15:37482842-37482864 CAAACTAAACCCATTAGCTGTGG - Intergenic
1131833685 15:96369796-96369818 CCAATTGATCCCTTTTCCTAGGG + Intergenic
1136099253 16:27981332-27981354 CCCATTGGCCTCATTTGCTGGGG - Intronic
1136944613 16:34632556-34632578 CCATTTGAAACCATTTGATGAGG + Intergenic
1136966800 16:34921365-34921387 CCATTTGAAACCATTCGATGAGG + Intergenic
1137086309 16:36128487-36128509 CCACTTGAATCCATTTGATGAGG + Intergenic
1137087406 16:36143489-36143511 CCATTTGAAATCATTTGATGAGG + Intergenic
1137221992 16:46463936-46463958 CCATTTGAAACCATTCGATGAGG - Intergenic
1138163376 16:54777032-54777054 CCAACTGATGCCATTTTCTGAGG + Intergenic
1142093695 16:88228135-88228157 CCAAATAAACCCATCTTCTGAGG + Intergenic
1143888078 17:10081016-10081038 CCAATTGTACTCTTTTTCTGAGG - Intronic
1146544389 17:33725679-33725701 GCAATTGCATCCATATGCTGAGG - Intronic
1149082053 17:52668751-52668773 TCCATTGAACCCATTTTCTCAGG - Intergenic
1150883302 17:69056553-69056575 CCCAGTGAACCCATTCACTGGGG - Intronic
1203184873 17_KI270729v1_random:105697-105719 CCATTTGAAACCATTTGATGAGG + Intergenic
1154168926 18:12036778-12036800 CCAAGTGAGCCCATTTGTTCTGG - Intergenic
1158175104 18:54647063-54647085 CCAACTGAACTCATTTGTTTGGG - Intergenic
1158907919 18:62031812-62031834 CCAAGTGTACTCATTTCCTGTGG + Intergenic
925508437 2:4596900-4596922 CAAATTCTACCCATTTACTGAGG - Intergenic
925821257 2:7801789-7801811 CCAATTTATCCCATTTGGAGTGG + Intergenic
927525065 2:23732180-23732202 CCAATTGAATCCCTATGGTGAGG - Intergenic
929515461 2:42602637-42602659 CAAATTGTCCTCATTTGCTGGGG + Intronic
930606557 2:53499131-53499153 ACAATTGAACACATTTTCTAGGG - Intergenic
937425660 2:121796500-121796522 CCATTTGAGCCACTTTGCTGTGG - Intergenic
940905200 2:159162876-159162898 CAAATTAAAAACATTTGCTGGGG - Intronic
944385116 2:199155165-199155187 ACAACTGAACACATTGGCTGTGG + Intergenic
945486625 2:210404496-210404518 CCATTTGATTGCATTTGCTGAGG + Intergenic
945637283 2:212371157-212371179 CCAATGAAACCCATAGGCTGGGG - Intronic
947805929 2:232968054-232968076 CTGATGGAACCCATTTGCTGAGG + Intronic
948585043 2:239014220-239014242 CCAATGGCTCACATTTGCTGGGG + Intergenic
1170580834 20:17698394-17698416 CCAATTAAACCTCTTTTCTGTGG + Intronic
1173713326 20:45179451-45179473 GCAATCAAACCCATCTGCTGTGG - Intergenic
1175050899 20:56154641-56154663 CCAACTCAACCCATGTGATGTGG + Intergenic
1181392147 22:22590967-22590989 CAAATTGTACCCATTTTCAGTGG - Intergenic
1181475728 22:23166810-23166832 CCACTGGAACCCACTTGCAGTGG + Intergenic
1182104683 22:27681018-27681040 GGAATTGAATCCATTTGCTCAGG + Intergenic
1183348743 22:37322582-37322604 CCAATTGTCCCCATTTTCTCAGG + Intergenic
951643393 3:24861104-24861126 CCAATGGAAAACATTTGGTGGGG + Intergenic
953806752 3:46077046-46077068 CCTCTTGAAGCCACTTGCTGTGG + Intergenic
953821399 3:46210328-46210350 CCCATTGTACACATCTGCTGTGG - Intronic
954286912 3:49625708-49625730 CCAATGGAACTCATTTGGAGTGG + Intronic
956435707 3:69232664-69232686 GCAGGTGCACCCATTTGCTGGGG - Intronic
962431320 3:135323163-135323185 GCAAATGAGCCCAGTTGCTGAGG - Intergenic
963363143 3:144302770-144302792 CCAATTTCTCCCATTTGCAGTGG - Intergenic
964793076 3:160471029-160471051 CCAATTTCTGCCATTTGCTGTGG + Intronic
965809451 3:172577016-172577038 CCAAATGAAACCATTTGGTGGGG - Intergenic
967633816 3:191777919-191777941 CAAATAGAAACCATTTTCTGGGG + Intergenic
969682393 4:8650559-8650581 CCAATAAAACCCATGAGCTGGGG + Intergenic
971085878 4:23274437-23274459 CCAGTTGAAACCATTTGCCAAGG - Intergenic
971598383 4:28561141-28561163 CCAATTTACCCCATGTTCTGTGG + Intergenic
973159441 4:46996894-46996916 CCAATTGTAACCATTTGAGGAGG + Intronic
975918013 4:79347725-79347747 CCAATTTATCCCATTTGGAGTGG + Intergenic
976838727 4:89406579-89406601 TAAATTGAGCCCATTTCCTGGGG + Intergenic
979176665 4:117673092-117673114 CAAATTATATCCATTTGCTGTGG + Intergenic
981836182 4:149057167-149057189 CCAACTGACACTATTTGCTGAGG - Intergenic
992554733 5:77892268-77892290 CCAATTAATCCCATTTTGTGCGG + Intergenic
994370502 5:98962016-98962038 CCAATTCTAACCATTTTCTGAGG + Intergenic
994811864 5:104529478-104529500 TCAAGTGTACCCATTTGTTGAGG - Intergenic
999365845 5:151022907-151022929 CCATGTGACCCCCTTTGCTGGGG - Intronic
1002852786 6:1011367-1011389 CCAATTCAAACCATTTACGGGGG - Intergenic
1010256992 6:73770118-73770140 CCAATTGATCTCATTCTCTGTGG - Intronic
1011103396 6:83749938-83749960 CCAATTGAATCCCTATGGTGAGG - Intergenic
1012185309 6:96207057-96207079 TCAATGGAACCCTTTAGCTGTGG + Exonic
1013198921 6:107872529-107872551 AAAAAAGAACCCATTTGCTGAGG + Intronic
1018579096 6:165292263-165292285 CCAATCATACACATTTGCTGTGG - Intronic
1019858517 7:3634059-3634081 CCAATTAGACACATTTGCTCTGG - Intronic
1025556251 7:62312521-62312543 CCATTTGAAATCATTTGATGAGG - Intergenic
1025566900 7:62446663-62446685 CCATTTGAAACCATTTGATGAGG + Intergenic
1026478958 7:70762685-70762707 ACCATTGACCCCATTTGCTGTGG + Intronic
1028278675 7:88893053-88893075 TAAATTTAACCTATTTGCTGAGG + Intronic
1041145592 8:54872879-54872901 CCAATTGGATCCATTTTATGTGG + Intergenic
1042107517 8:65344537-65344559 CCACTTGAGCCCAGTTGGTGAGG + Intergenic
1042427992 8:68671611-68671633 CAAATTGAAACCAATTGCTAAGG - Intronic
1043749478 8:83917389-83917411 CAAATAGAACCCATTTATTGAGG - Intergenic
1046617823 8:116497059-116497081 CCCATTGAATCCACTTGCTTTGG + Intergenic
1050811791 9:9757908-9757930 CCAAGTGAAGCCATTTCCTGGGG + Intronic
1051577188 9:18630194-18630216 CTAATTGTACCCTTTTACTGAGG + Intronic
1051999231 9:23256490-23256512 CAAAGTGAAAGCATTTGCTGAGG - Intergenic
1055045164 9:71916534-71916556 CCTATTGAACTAATTTGTTGTGG + Intronic
1056434888 9:86566221-86566243 CCAATTTATCCCATTTGGAGTGG - Intergenic
1056441744 9:86628924-86628946 CCCATTGAAGACATTTCCTGAGG + Intergenic
1057212965 9:93210477-93210499 CCCATTGAACCCAGGTGCTGGGG + Intronic
1058210379 9:102161049-102161071 CCAATTTCACCCATTTGGAGTGG - Intergenic
1059742783 9:117169258-117169280 CCAAATGTAGCTATTTGCTGTGG + Intronic
1186103348 X:6180078-6180100 CCAATTGAACCAATTTATTAAGG - Intronic
1187286248 X:17906635-17906657 CCAGTTGAAGACATGTGCTGAGG + Intergenic
1188010738 X:25053055-25053077 CCCATTTTACCCATTTGCTGAGG - Intergenic
1193836177 X:86347370-86347392 GCAAGTGCACCCATGTGCTGAGG - Intronic
1193871890 X:86808314-86808336 CCAATTATGCTCATTTGCTGTGG - Intronic
1197526944 X:127575792-127575814 CCAATTTATCCCATTTGGTATGG - Intergenic
1197602185 X:128543591-128543613 CCATTTGAACTCCTTGGCTGGGG - Intergenic
1199167475 X:144693825-144693847 CCAAGTGAATCCATTCTCTGGGG + Intergenic
1199703092 X:150399844-150399866 CCATTTGTATGCATTTGCTGGGG - Intronic
1199849024 X:151712058-151712080 CCAGGTGCACCCATTTGCTTGGG + Intergenic
1200345216 X:155440805-155440827 CCAATTTAACCCATTTGGATTGG - Intergenic
1201578297 Y:15484105-15484127 CCAACTGATACCATTTTCTGTGG - Intergenic