ID: 1090956665

View in Genome Browser
Species Human (GRCh38)
Location 11:131519159-131519181
Sequence TGAGTTTCAAATTGAGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 198}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090956662_1090956665 -2 Left 1090956662 11:131519138-131519160 CCACTTCATGAGGAGAAGCCCTG 0: 1
1: 0
2: 0
3: 11
4: 185
Right 1090956665 11:131519159-131519181 TGAGTTTCAAATTGAGAGCCAGG 0: 1
1: 1
2: 0
3: 10
4: 198
1090956661_1090956665 6 Left 1090956661 11:131519130-131519152 CCTCAGGGCCACTTCATGAGGAG 0: 1
1: 0
2: 1
3: 13
4: 179
Right 1090956665 11:131519159-131519181 TGAGTTTCAAATTGAGAGCCAGG 0: 1
1: 1
2: 0
3: 10
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090956665 Original CRISPR TGAGTTTCAAATTGAGAGCC AGG Intronic
901237376 1:7674481-7674503 TGAAATTCAAAATGAAAGCCAGG + Intronic
904135796 1:28311568-28311590 AGGGTGTCAAATTGAGAACCAGG - Intergenic
907714864 1:56917162-56917184 AGAGTTTCAAATTAAGTGCAAGG + Intronic
908221078 1:62007197-62007219 TGAGTTGGAAATTCAGAACCTGG + Intronic
908373461 1:63506945-63506967 TGAGTATATAATTGGGAGCCAGG + Intronic
910210574 1:84788669-84788691 TAACTTTTAAATTGAAAGCCTGG - Intergenic
914228229 1:145739968-145739990 TGAGAATCAAAATGAGAGTCTGG + Exonic
915933230 1:160073384-160073406 TGAGTTTGAAATGGATATCCGGG - Intergenic
917592210 1:176487867-176487889 TCAGTTTAAAATTGAGAGACTGG - Intronic
918877052 1:190061256-190061278 TAAGTTTTAAATTTAGACCCTGG + Intergenic
919201172 1:194357199-194357221 AGAGTTTCTAACTGACAGCCAGG + Intergenic
920556184 1:206906707-206906729 AGAGTTTCAAGTAGAGAGGCAGG + Intronic
921008064 1:211113595-211113617 TGAGTGTCAAATGGGGAGCCAGG - Intronic
922086863 1:222357481-222357503 TGAGATTCAAACTGCGAGGCGGG + Intergenic
924301431 1:242642579-242642601 TAGGTTTCAACTAGAGAGCCAGG - Intergenic
924786237 1:247202542-247202564 TTTGTTTCTAATTGAAAGCCTGG + Intergenic
1064351083 10:14577589-14577611 TGATTTTCAGGTTGAGATCCTGG + Intronic
1065145866 10:22767468-22767490 TGAGTTGTAACTTTAGAGCCAGG + Intergenic
1065487813 10:26251848-26251870 TGAGTTTAAGACTGAGAGCCTGG + Intronic
1068413996 10:56693043-56693065 GGAGTTTGAAATTCAGAGACGGG + Intergenic
1069171728 10:65239373-65239395 TGGGCTTCAAATTGTGAACCAGG + Intergenic
1070090278 10:73278050-73278072 TGAGTTTGGATTTCAGAGCCTGG + Intronic
1070312138 10:75281643-75281665 TGGGTATCAAAATGAGAGCCTGG - Intergenic
1070408406 10:76116792-76116814 TGAGTTTCATCTGGTGAGCCTGG + Intronic
1071555731 10:86599983-86600005 TGAGATTCAAACTGCGAGGCAGG + Intergenic
1071582097 10:86781147-86781169 TAAGATTCGAAATGAGAGCCGGG - Intronic
1074253258 10:111775164-111775186 TGAGTATCATCTTGACAGCCTGG - Intergenic
1074697373 10:116061966-116061988 TGATTTTCAAATTGAGGAGCTGG + Intronic
1078736461 11:14025065-14025087 TGAGTTTTAAAGTAAGAGACTGG + Intronic
1080680575 11:34472110-34472132 TGATGTTCAAATTAAGAGTCTGG - Intergenic
1080794411 11:35550347-35550369 TTAGCTTCAAATTCAGAGGCTGG - Intergenic
1081169115 11:39845274-39845296 TTAATTTCAAATTAAGAGTCAGG - Intergenic
1081268049 11:41050984-41051006 TTAGTTTCATACTGGGAGCCTGG + Intronic
1081560231 11:44207379-44207401 TGAGTTTTAAGTGGAGAGGCTGG + Intronic
1083312489 11:61791555-61791577 TGAATTAGAAATTGAGGGCCAGG - Intronic
1084401513 11:68946568-68946590 CTAGTTTCATAGTGAGAGCCTGG - Intergenic
1087033601 11:93732271-93732293 AGGGTGTCAAATTGAGAACCAGG - Intronic
1088853921 11:113729201-113729223 TGAGTTTCAAATACACTGCCTGG + Intergenic
1090810643 11:130238635-130238657 TCAGTTTAAAAATCAGAGCCTGG - Intronic
1090956665 11:131519159-131519181 TGAGTTTCAAATTGAGAGCCAGG + Intronic
1092793639 12:12090200-12090222 TGAATTTCACAGTGAGAGCTGGG + Intronic
1093145328 12:15558232-15558254 TGAGTTTAAAATGGAGATGCTGG - Intronic
1093904015 12:24667721-24667743 TGTCTTTTGAATTGAGAGCCTGG - Intergenic
1094703491 12:32893358-32893380 TCTGTTTCAACTTGAGAGACAGG + Intronic
1095440651 12:42236531-42236553 TAAGTTTAAAATTTAGAGACAGG - Intronic
1097265525 12:57742225-57742247 TGAGTTTCAAACCCACAGCCTGG + Intronic
1097967154 12:65593660-65593682 AGAGTTTCAAGTTGGAAGCCTGG + Intergenic
1099646183 12:85359638-85359660 TGAGTCTCAGGTAGAGAGCCAGG - Intergenic
1104872739 12:132011991-132012013 TGGGTTTTAAATTCAGAGCTGGG - Intronic
1106627738 13:31438049-31438071 TGTGATTCAAATTGATAGCAGGG - Intergenic
1108558757 13:51622542-51622564 TAAGTTTCAAATTCTGAGCCTGG + Intronic
1109495937 13:63171913-63171935 AGAGTTTCAAATTGATTGGCTGG + Intergenic
1110935059 13:81277400-81277422 TCAGATACAAATTGAAAGCCTGG + Intergenic
1112198900 13:97255962-97255984 AGAGTGTCAAATTGAGAACTAGG + Intronic
1112497042 13:99913495-99913517 TGATTTACAAAATGAGAGACAGG - Intergenic
1112500177 13:99936898-99936920 TGAGATTCAAATTGAATGACGGG - Intergenic
1113080681 13:106516670-106516692 TGAGCGTCACATGGAGAGCCAGG + Intronic
1114898356 14:27023541-27023563 TGGGCTTCAAATTGAAAGCTTGG - Intergenic
1115385097 14:32788460-32788482 TTAGTTTCAATGTGAGATCCTGG - Intronic
1115447604 14:33509457-33509479 TGAGATTAAAATTAAGATCCAGG - Intronic
1116623200 14:47232568-47232590 TGAGGTTCACCTTGAAAGCCAGG + Intronic
1120262935 14:82211184-82211206 AGAGTTTAAAATTGAGAGAAAGG - Intergenic
1123413488 15:20078648-20078670 TGAGTTTGAAAGTGTCAGCCGGG + Intergenic
1123522830 15:21085760-21085782 TGAGTTTGAAAGTGTCAGCCGGG + Intergenic
1123920963 15:25069471-25069493 TGAGTTTCAAACTGAGGTGCTGG + Intergenic
1124702497 15:31928608-31928630 AGGGTGTCAAATTGAGAACCAGG + Intergenic
1124862322 15:33454427-33454449 TGAGTTTAAACTTAAGACCCTGG + Intronic
1128285547 15:66433807-66433829 TGGGTTTCAAATTGAAGTCCCGG - Intronic
1128954371 15:71924535-71924557 AAAATTTCAAATTGGGAGCCGGG - Intronic
1130289413 15:82584064-82584086 TGGGTTTCACATTGTTAGCCAGG - Intronic
1130564912 15:84985744-84985766 GGATTTTCAACTTGACAGCCTGG - Intronic
1131819028 15:96252675-96252697 TGGGTTTCAGAGTGAGACCCTGG + Intergenic
1133124801 16:3639759-3639781 TGAATTTCAAATTGTTGGCCAGG + Intronic
1134199309 16:12184676-12184698 TGAGTTTTGAACTGGGAGCCTGG + Intronic
1135482253 16:22830617-22830639 TAAGTTCAATATTGAGAGCCTGG + Intronic
1137009238 16:35307076-35307098 TGACTTTCATATTTGGAGCCAGG - Intergenic
1137034734 16:35560119-35560141 TGACTTTCAAATTTGGAGCCAGG - Intergenic
1137567170 16:49540574-49540596 TGAGTTTAACATTGTGGGCCAGG - Intronic
1137575942 16:49600495-49600517 TGAGTTTAGAATTGTGAGGCTGG - Intronic
1138790937 16:59903260-59903282 TAAGTTTTAAATTGTGGGCCAGG + Intergenic
1139833077 16:69815965-69815987 TAAGTTTAAAATTGCCAGCCTGG - Intronic
1141049572 16:80748214-80748236 TGAGTTTTAAAGGCAGAGCCAGG - Intronic
1141143102 16:81509989-81510011 TGAGGTTCAATTTGCCAGCCAGG - Intronic
1143786302 17:9258390-9258412 TGATTTCCAGATTGAGAGGCTGG + Intronic
1148155275 17:45421030-45421052 TGAGATTCAAATTTGCAGCCTGG + Intronic
1148607749 17:48943159-48943181 TGAGTTTAAAATTGAGAGCCGGG - Intronic
1148791004 17:50172638-50172660 TGAGTTTAAAACTGGGGGCCAGG - Intronic
1149094515 17:52824782-52824804 GGAGTGTCACAATGAGAGCCAGG - Intergenic
1149855982 17:60083264-60083286 TGGGTTTGAAATTCAGAGTCAGG + Intergenic
1150386966 17:64769683-64769705 TGAGATTCAAATTTGCAGCCTGG + Intergenic
1150548417 17:66186837-66186859 TGATTTTTAAATTGAGAGTTAGG - Intronic
1150743342 17:67797226-67797248 TGAGGATCAAATTGGGAGGCAGG + Intergenic
1150839677 17:68596105-68596127 TGATTTTCAAAGAGAGACCCAGG + Intronic
1152472817 17:80499844-80499866 TGAGTTTGAGATTGAGGCCCAGG + Intergenic
1152804454 17:82348484-82348506 TGAGTTTCTATTTGAGTGCTGGG + Intergenic
1156096928 18:33544753-33544775 TGATTTTCAAAGTGAGGTCCTGG - Intergenic
1158686448 18:59619269-59619291 TGTTTTCCAAATTGAAAGCCAGG + Intronic
1158854592 18:61530297-61530319 TGGGTTTTGAAATGAGAGCCAGG - Intronic
1158868829 18:61664391-61664413 TGACTTTCACCTTGAGAGGCAGG - Intergenic
1161516665 19:4700221-4700243 TGAGTTCCAGACTGACAGCCAGG - Exonic
1163130265 19:15268057-15268079 TCAGTTCTAAACTGAGAGCCTGG + Intronic
1165570821 19:36773212-36773234 TGAGTTCCAAACTAACAGCCAGG - Exonic
1166272417 19:41723103-41723125 TGAGTTTCACAGTGTTAGCCAGG + Intronic
1166315547 19:41987606-41987628 TGAGTGTCACATAGAGACCCAGG - Intronic
1167822189 19:51938295-51938317 TGAGTTTCACATTGTCACCCAGG + Intronic
925626163 2:5843723-5843745 TGAGTTTCAAAGTAAGTGCCTGG + Intergenic
929062299 2:37935006-37935028 TGAGTTTCAAAATTAGACTCAGG + Intronic
929171820 2:38939809-38939831 AGAGTTTAAAATTGACAGCTGGG - Intronic
931233946 2:60397920-60397942 TGAGGTGCAAAATGAGAGACGGG + Intergenic
932378203 2:71256991-71257013 TGATTTTCAAAGTGTGATCCAGG + Intergenic
933058287 2:77701723-77701745 TGAATTCCAAATAGAGAGCTGGG - Intergenic
933225019 2:79738126-79738148 TGAGTATAAAACTGAGACCCAGG - Intronic
934609696 2:95725839-95725861 TGAGATTCAGATACAGAGCCTGG + Intergenic
936543013 2:113367409-113367431 TGAGATTCAGATACAGAGCCTGG + Intergenic
938823333 2:134980243-134980265 TGATTTTCAAATTTTTAGCCAGG - Intronic
938838759 2:135137313-135137335 AGGGTGTCAAATTGAGAACCAGG + Intronic
938968323 2:136407891-136407913 TGTGGTTCAAATTGAGAGCGTGG - Intergenic
939343969 2:140938499-140938521 TGAGTATGCAATTGAGAGCAAGG + Intronic
940141239 2:150493338-150493360 TGATTTTCAAATTCAGTGCCAGG - Intronic
941167142 2:162094823-162094845 TGAATTTTAATTTGAGAACCTGG - Intergenic
942911349 2:181247760-181247782 AGAGTTTCAAATTGAGGGTGAGG + Intergenic
945912003 2:215660447-215660469 TGACTTAGAAAGTGAGAGCCAGG - Intergenic
946125938 2:217562724-217562746 TGACTTGCAAATTAACAGCCTGG - Intronic
948755497 2:240157451-240157473 TGAGTTTCTAATTGTGCACCTGG - Intergenic
1169845889 20:9990993-9991015 TGAGTTTAAAAGTGAGATGCCGG + Intronic
1175604588 20:60302235-60302257 TGAACTTCAAAGTGAGAGACAGG - Intergenic
1176012095 20:62903440-62903462 TGAGTTTGGAAGTGAGAGGCTGG - Intronic
1176654074 21:9574306-9574328 CGTGTTTGAAATTGAGAGTCTGG - Intergenic
1177735335 21:25082045-25082067 TGAGGTTGATTTTGAGAGCCTGG + Intergenic
1178617353 21:34145580-34145602 GGAGGTTGAAAATGAGAGCCTGG + Intergenic
1179460980 21:41534962-41534984 TGAGTTTAAAATTTAGAAACAGG - Intergenic
1182372155 22:29818930-29818952 TGGGTTTGAAGGTGAGAGCCTGG - Intronic
1183330103 22:37214878-37214900 TGAGTTTCAGATGGAGGCCCTGG - Intergenic
1183785090 22:40024557-40024579 TGTGTCCCGAATTGAGAGCCAGG - Intronic
949373594 3:3362713-3362735 TGAGTTTTAAAATGAGAGGGAGG + Intergenic
951788066 3:26445558-26445580 TGCTATTCAAATTGAGAGACTGG - Intergenic
952707807 3:36398039-36398061 TGAAGGTCCAATTGAGAGCCAGG - Intronic
952854505 3:37758026-37758048 TAAATTGCAAATTGAGGGCCGGG + Intronic
955513468 3:59704621-59704643 TCATTTTCAAAATGAGAGGCTGG + Intergenic
956905364 3:73759925-73759947 TGAGTTTCACATGGAGAAGCTGG - Intergenic
958132285 3:89442930-89442952 TATGTTTGAAATTTAGAGCCTGG - Intronic
958622528 3:96580252-96580274 TGAGTTTAAAAGTGATAGCAAGG - Intergenic
959172793 3:102862815-102862837 TGAGTTACAAATTCAGCGGCTGG - Intergenic
960851304 3:122057876-122057898 TGAGTTGCATATTGAGAGGGAGG + Intronic
963759840 3:149276661-149276683 TCATTTTCAAATTCTGAGCCTGG + Intergenic
970392553 4:15629549-15629571 TGAGCTTAAAATTTAGAGACAGG - Intronic
972224467 4:36996238-36996260 TAAGCTTCAAATTGAAAACCAGG + Intergenic
973162659 4:47037616-47037638 TGAGTTTACATTTGAAAGCCTGG + Intronic
973280157 4:48351861-48351883 TGGGCTTAAAAGTGAGAGCCGGG + Intronic
975921397 4:79394607-79394629 TGAGAATCAATTTTAGAGCCCGG + Intergenic
979287660 4:118944301-118944323 TGAGTTTCAATTTTAGCACCAGG - Intronic
981264215 4:142762176-142762198 GGAGTTGCAGAATGAGAGCCAGG - Intronic
985948448 5:3204518-3204540 TAAGTTTCAAATTCTGAGCTGGG + Intergenic
987251531 5:16106048-16106070 TGAGTTTCATAATGGGAGCTGGG + Intronic
987472526 5:18350863-18350885 TGAGCTTCACAATGAGAACCTGG + Intergenic
987561535 5:19529862-19529884 TAAGTTTCAATTTGGGAGCATGG - Intronic
988861324 5:35283083-35283105 TGAGTTTAAAATTAAAAGTCTGG - Intergenic
989150405 5:38293770-38293792 TGACTTTCATGTTGGGAGCCTGG + Intronic
992688547 5:79221199-79221221 AGGGTGTCAAATTGAGAACCAGG + Intronic
994137689 5:96306779-96306801 TGAGTTCCAATTTGATTGCCTGG + Intergenic
995039664 5:107573196-107573218 TGTGTTTGAAGTTGAGAGCTGGG - Intronic
995765030 5:115605123-115605145 TGAGTGGCAAAATGAGAGCTCGG + Intronic
998546164 5:143029676-143029698 TGAGATTACAGTTGAGAGCCAGG + Intronic
999443550 5:151621112-151621134 AGTGCATCAAATTGAGAGCCTGG + Intergenic
999528919 5:152440085-152440107 TCAGTTTCAAACTGAGAGACAGG - Intergenic
1000136395 5:158356570-158356592 TGAGTCTCACACTGATAGCCTGG + Intergenic
1000983150 5:167838571-167838593 TTAGTTTCAATTTGAAAGCATGG - Intronic
1004447610 6:15714804-15714826 TGAAATTCAAAGTGAGACCCAGG + Intergenic
1005459001 6:26049944-26049966 AGGGTGTCAAATTGAGAACCAGG + Intergenic
1006661902 6:35653609-35653631 AGGGTGTCAAATTGAGAACCAGG + Intronic
1008137374 6:47792688-47792710 TAAGTTTAATATTGAGAACCAGG + Intronic
1010345632 6:74806917-74806939 TGAGTTTCAGGTTGAGAGAGAGG - Intergenic
1010765228 6:79771172-79771194 TGAGTTCCAAATTGAGGGAGAGG + Intergenic
1013511573 6:110849266-110849288 AGGGTGTCAAATTGAGAACCAGG + Intronic
1016068757 6:139711711-139711733 TTAGTATCAATATGAGAGCCTGG - Intergenic
1016640937 6:146348645-146348667 TCAGTGTCATATAGAGAGCCGGG - Intronic
1018398395 6:163399132-163399154 TGAGTCCCAAAATGAGAGCATGG - Intergenic
1019828792 7:3305103-3305125 TGAGTTTCAAATCATGAACCTGG - Intronic
1019941124 7:4292054-4292076 TGCGATTGATATTGAGAGCCTGG - Intergenic
1020026971 7:4906178-4906200 TGAGATTCCAATTCAGATCCTGG + Exonic
1022042214 7:26591956-26591978 TGGGTTTCAAACTCAGAGACAGG + Intergenic
1023916314 7:44591964-44591986 TGCTTTTCAAATTGATGGCCAGG - Intergenic
1028172226 7:87612100-87612122 TGAGTTGCAAAGTGAGTGGCAGG + Intronic
1029987078 7:104931842-104931864 TGACTGTCAAAGTCAGAGCCTGG - Intergenic
1031235722 7:119173863-119173885 TGAGTTTCAAATTGAGGAGAAGG - Intergenic
1031250927 7:119379344-119379366 TGCTTTTCATATTGAGAGACAGG - Intergenic
1031943116 7:127810317-127810339 TGTGTTTCTAATTGAGAGAGTGG + Intronic
1035757433 8:2044683-2044705 GGAGTTGCAATTTGTGAGCCAGG + Intergenic
1036498447 8:9292004-9292026 TGATTTGGAACTTGAGAGCCAGG + Intergenic
1037906968 8:22721281-22721303 TGAGGTCAAAATTGAGACCCAGG + Intronic
1044763039 8:95542494-95542516 TGTGTTTCTAATTGAGTGTCAGG - Intergenic
1046023110 8:108690152-108690174 TGATTTTAAAAGTCAGAGCCAGG + Intronic
1048354749 8:133643984-133644006 AGGGTGTCAAATTGAGAACCAGG - Intergenic
1050676173 9:8056322-8056344 TGAGATTCCAATTGTAAGCCAGG - Intergenic
1050876262 9:10640630-10640652 TCAGTTTCAAATGCAGAGCATGG + Intergenic
1056105630 9:83343664-83343686 TCTGTTTCAAACGGAGAGCCAGG + Intronic
1057321651 9:94018733-94018755 ACAATTTCAAATTGACAGCCTGG - Intergenic
1058480694 9:105391444-105391466 TGAGTTGCAAATTAATTGCCAGG + Exonic
1060216718 9:121742879-121742901 TGAGGCTCAAACTGAAAGCCTGG + Intronic
1062684241 9:137801927-137801949 TTTGTTTCAAAGAGAGAGCCAGG - Intronic
1188157388 X:26756394-26756416 TTATTTTCATATTGAGAGACAGG - Intergenic
1189469085 X:41300226-41300248 AGAGTCTAAAACTGAGAGCCAGG + Intergenic
1192592127 X:72369048-72369070 TGAGAACCAAACTGAGAGCCTGG - Intronic
1193844926 X:86456169-86456191 TGAGTTTCAGTGTGAGAACCTGG + Intronic
1194990779 X:100544331-100544353 AGAGTTCCCATTTGAGAGCCAGG - Intergenic
1195646712 X:107238954-107238976 TGATATTCAAATTGATATCCAGG + Exonic
1197531225 X:127629037-127629059 TGGATTACAAATTGATAGCCCGG + Intergenic
1198074969 X:133185355-133185377 TGGGATTCAAACTGAGAGGCAGG + Intergenic
1198748055 X:139910183-139910205 AGGGTGTCAAATTGAGAACCAGG + Intronic
1201601885 Y:15738599-15738621 TGAACTTCAGATTCAGAGCCAGG + Intergenic