ID: 1090961441

View in Genome Browser
Species Human (GRCh38)
Location 11:131561041-131561063
Sequence TTTGCAACACAGAACTAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 155}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090961441_1090961446 10 Left 1090961441 11:131561041-131561063 CCTTCCTAGTTCTGTGTTGCAAA 0: 1
1: 0
2: 0
3: 16
4: 155
Right 1090961446 11:131561074-131561096 GGCTGCAGGTGCAATCTGAAGGG 0: 1
1: 0
2: 0
3: 19
4: 157
1090961441_1090961447 26 Left 1090961441 11:131561041-131561063 CCTTCCTAGTTCTGTGTTGCAAA 0: 1
1: 0
2: 0
3: 16
4: 155
Right 1090961447 11:131561090-131561112 TGAAGGGAACAAGCGCAGTCAGG 0: 1
1: 0
2: 0
3: 8
4: 98
1090961441_1090961444 -4 Left 1090961441 11:131561041-131561063 CCTTCCTAGTTCTGTGTTGCAAA 0: 1
1: 0
2: 0
3: 16
4: 155
Right 1090961444 11:131561060-131561082 CAAAAGTCAGAAGTGGCTGCAGG 0: 1
1: 0
2: 1
3: 19
4: 259
1090961441_1090961445 9 Left 1090961441 11:131561041-131561063 CCTTCCTAGTTCTGTGTTGCAAA 0: 1
1: 0
2: 0
3: 16
4: 155
Right 1090961445 11:131561073-131561095 TGGCTGCAGGTGCAATCTGAAGG 0: 1
1: 0
2: 1
3: 15
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090961441 Original CRISPR TTTGCAACACAGAACTAGGA AGG (reversed) Intronic
900881516 1:5385055-5385077 ATTGCAACCTAGAACAAGGAGGG - Intergenic
909635271 1:77810787-77810809 TATGCTACACAGAGCTATGATGG + Intronic
910462980 1:87468074-87468096 TTTGCAAAACATAACTTGCAGGG + Intergenic
910614339 1:89180530-89180552 TTTGGAACAGAGAACTAGAAAGG - Intergenic
911547723 1:99239939-99239961 TCTGCAACACAGAGCGGGGATGG - Intergenic
911622935 1:100087379-100087401 TTTGTAATGTAGAACTAGGATGG + Intronic
916597006 1:166253561-166253583 TTTGCCAGAGAGAACTAGGGAGG - Intergenic
918746024 1:188200852-188200874 TAAGGAACACAGAAGTAGGAAGG - Intergenic
922121123 1:222669819-222669841 TATGCTACACAGAGCTATGATGG + Exonic
1064745795 10:18477045-18477067 TCTGCCACACAGAAAAAGGAGGG + Intronic
1069943248 10:71969595-71969617 TTTGCAGCTCAGCACTAGGAAGG - Intronic
1070900309 10:80022668-80022690 TTTGCAAGACTGGACTGGGAAGG + Intergenic
1072045604 10:91651655-91651677 GGTGTGACACAGAACTAGGAGGG + Intergenic
1072752661 10:97994352-97994374 TTTGCAACACAGCACCAGATAGG + Intronic
1076048382 10:127313007-127313029 TTTGCAGCCCAGGACTGGGAGGG - Intronic
1076920178 10:133447292-133447314 TTTGCAAACTAGAACTAGAAGGG - Intergenic
1078602041 11:12741676-12741698 TCTCCAACACAGAACTAATAAGG - Intronic
1079744232 11:24105180-24105202 TTTTCAACATAGTACTAGAAGGG + Intergenic
1079942960 11:26704874-26704896 TATCAAACAAAGAACTAGGAAGG + Intronic
1080907895 11:36565075-36565097 TTTGAAAGCCAGAACTAGAAGGG - Intronic
1082067640 11:47913919-47913941 TCTGCATTACAGAACCAGGATGG + Intergenic
1082185329 11:49173356-49173378 TTTGGAACACTGAAAAAGGAAGG - Exonic
1085877050 11:80421051-80421073 TTTTCACCACAGTCCTAGGAAGG + Intergenic
1086023433 11:82260509-82260531 TTTCCAATACAGAAGTAGGAAGG - Intergenic
1086680994 11:89671985-89672007 TTTGGAACACTGAAAAAGGAAGG + Intergenic
1090961441 11:131561041-131561063 TTTGCAACACAGAACTAGGAAGG - Intronic
1093258640 12:16904856-16904878 TTTGCAACACAGAGCTGGAAAGG - Intergenic
1094034209 12:26049207-26049229 TTTACAAAACATAACTTGGAAGG + Intronic
1094164286 12:27426189-27426211 TTTGTATTACAGAAGTAGGATGG + Intergenic
1100855629 12:98755075-98755097 TGGGCAACACAGCACTTGGAAGG - Intronic
1101832146 12:108266989-108267011 TTTGAATCACCGACCTAGGATGG - Intergenic
1102915767 12:116750634-116750656 CTAGCATCACACAACTAGGAGGG - Intronic
1103193311 12:119020819-119020841 TTTGGAACCCAGAATGAGGAAGG + Intronic
1104458359 12:128933808-128933830 TTCTGAATACAGAACTAGGAGGG + Intronic
1106816198 13:33409998-33410020 TGTGCAACACAGACCAGGGAAGG - Intergenic
1109462311 13:62677641-62677663 TTTGCAACACAAAATAACGAAGG + Intergenic
1109958395 13:69600014-69600036 TTAGCAACAAAGAAATAGAAAGG - Intergenic
1111226920 13:85286626-85286648 ATTACAACAGATAACTAGGAGGG - Intergenic
1113034322 13:106032087-106032109 TTTGCAAGTCATTACTAGGAAGG + Intergenic
1113821421 13:113216238-113216260 TGTGGAAGACAGAACAAGGAAGG - Intronic
1114684888 14:24519295-24519317 TTAGAAACCCAGAACTTGGAAGG - Intergenic
1116250193 14:42472368-42472390 TTTGCAAGAAGGAACAAGGAAGG - Intergenic
1116855314 14:49946881-49946903 TTTGCAACACGGCTCTAGCAAGG - Intergenic
1119244143 14:73089181-73089203 TTTTTAACAAAGAACTTGGAGGG - Intronic
1120591841 14:86384605-86384627 TCTGGAACACAGAGCTGGGATGG - Intergenic
1120820339 14:88906295-88906317 TTTGCCTCACAGTACTAGGTAGG + Intergenic
1120958084 14:90100675-90100697 TTTGCATCTCAGCACTAGGTTGG + Intronic
1121371122 14:93359353-93359375 TTTGCAAAACAGATTTATGAGGG + Intronic
1127406856 15:58658440-58658462 TTTTCAAAAAAGAACAAGGATGG - Intronic
1127727909 15:61768387-61768409 ATTGCACCATAGAACTAGAAGGG - Intergenic
1128614384 15:69098047-69098069 TTTAAAAAACAGAACTAAGAGGG + Intergenic
1129151983 15:73694953-73694975 ATTGCACCACTGAACTATGATGG + Intronic
1130241956 15:82202122-82202144 TTTGCAACACTGAATAAGAATGG + Intronic
1132171888 15:99666726-99666748 TTTACAACACAGAAATAGTGTGG + Intronic
1133538635 16:6726108-6726130 TTTGTTACACAGAGCCAGGAGGG + Intronic
1133794647 16:9035934-9035956 TTTCCAACACAAAATGAGGATGG - Intergenic
1134609419 16:15596664-15596686 TTTGGAATATAGAATTAGGATGG - Exonic
1137015124 16:35366738-35366760 GTTGTAACACATACCTAGGAAGG - Intergenic
1147566254 17:41538046-41538068 GTTCCAACACAGATCTAGGAGGG - Intergenic
1149593523 17:57849510-57849532 TCTGCAACACAGAACGGGGAAGG + Intronic
1150322075 17:64223414-64223436 TGTGAAAGACAGAGCTAGGAAGG - Intronic
1151361522 17:73592146-73592168 CTTGCACCACAGAAAAAGGAAGG + Intronic
1152393757 17:80019038-80019060 TTTGAAACACAGAAGGAGGTGGG - Intronic
1153579187 18:6554674-6554696 TTCTCAGCACAGAACTACGATGG - Intronic
1155661930 18:28259515-28259537 TTTGCAAAATAAAACAAGGAGGG + Intergenic
1157368749 18:47090751-47090773 GTAGAAACTCAGAACTAGGATGG + Intronic
1157987531 18:52456099-52456121 TTTTCAACAGAGGACTAGGAAGG - Intronic
1160149000 18:76385208-76385230 TTTCCAAGACACATCTAGGAAGG - Intronic
1160300894 18:77677260-77677282 GTTGCAAAACAGAAATAGCAGGG + Intergenic
1165234469 19:34409383-34409405 TCTGCAACACAGATGTAGTAGGG - Exonic
924994654 2:348015-348037 TTTTCAACAAACATCTAGGAAGG - Intergenic
925392103 2:3502329-3502351 TTTGTAACACATAACAAGGTAGG - Intronic
925633420 2:5917876-5917898 TCTGTGACACTGAACTAGGAGGG - Intergenic
926749783 2:16189511-16189533 TTTGCAACACAGAACATTGGTGG + Intergenic
927243085 2:20935691-20935713 TTTGCAACCCAGAACCTGCAAGG + Intergenic
931214755 2:60230504-60230526 TTCTCAACCCAGAAATAGGAAGG - Intergenic
932863829 2:75321162-75321184 TGTGTAACACATAACTGGGAAGG - Intergenic
933835040 2:86239261-86239283 ACAGCAACACAGAACTAAGAAGG + Intronic
935938461 2:108213104-108213126 ATTGCAACACAGTAATAGTAGGG - Intergenic
937610432 2:123855047-123855069 TTTTCAACATAGTAGTAGGAGGG + Intergenic
942569461 2:177298644-177298666 TTTGCAGCACATAATTAGGTTGG - Intronic
942677028 2:178438045-178438067 TTTTCAACATAGAACTATAAAGG - Intronic
943192971 2:184704462-184704484 TTTCCAACAGAGAAATAGGAAGG + Intronic
943872002 2:193011770-193011792 TTTGCAGGACAGAACTGGGAGGG + Intergenic
945929404 2:215840055-215840077 GTTGCAACACAGAACCACGTGGG - Intergenic
948550111 2:238765541-238765563 TTTGCAACAGAGACCTTGCAGGG - Intergenic
1171252197 20:23656902-23656924 TTTCCAAGAGATAACTAGGACGG - Intergenic
1174066459 20:47869155-47869177 TTTACAACAGAGAACTCTGATGG - Intergenic
1181166272 22:20984920-20984942 TTTGCAACAAAGAAATGGCAGGG + Intronic
1184527795 22:45035739-45035761 TCTGCAACACTGAACTAAGCGGG + Intergenic
950310440 3:11953349-11953371 TTAGCAGCTCACAACTAGGAAGG - Intergenic
950692122 3:14667650-14667672 TTTGAAACACAAAAATAGTATGG - Intronic
950966204 3:17147811-17147833 TTTGATACACACAACTTGGATGG + Intergenic
951620481 3:24596015-24596037 TTTGCAAAACATGACAAGGAGGG + Intergenic
951842083 3:27045235-27045257 TTTGAAAGACAGACCCAGGAAGG - Intergenic
952535403 3:34304179-34304201 TTTGGAACAGAGAAATAGAATGG - Intergenic
952538581 3:34341111-34341133 TTTGCAACACAGAGTTAAAAAGG - Intergenic
953532633 3:43752355-43752377 TTTGCATCAGAGTCCTAGGAAGG - Intergenic
954979442 3:54731026-54731048 TCTACCACACAGAACTAGGTTGG + Intronic
955048235 3:55381280-55381302 TTTGCAACACAGAACCAACAGGG + Intergenic
958185557 3:90115244-90115266 TTTCCAACACAGAACTTTGGGGG - Intergenic
958493212 3:94805341-94805363 TTTCCAAAACATTACTAGGATGG - Intergenic
959353078 3:105292732-105292754 TTTGGAATACAGAACCAGTAGGG - Intergenic
962586492 3:136847496-136847518 TTTGAAACACAGAACCAGTAGGG + Intronic
962625998 3:137226792-137226814 GTAGCAGCACAGAACTGGGACGG - Intergenic
964167464 3:153725741-153725763 TTTACAACAAAGAAGTAGCAGGG - Intergenic
966674371 3:182569311-182569333 TTTGCGTCACAGAATTAGCATGG - Intergenic
967439319 3:189488649-189488671 TTTGCATCACATACCCAGGATGG - Intergenic
968982571 4:3858346-3858368 TTTCCACAACAGGACTAGGAAGG + Intergenic
969937852 4:10700432-10700454 TTTGCAAGACAGACTTAGGTGGG + Intergenic
973857741 4:55030347-55030369 TTAGCAACACAGTTCTAGGTGGG + Intergenic
974010383 4:56601320-56601342 ATTGCAACTTAGATCTAGGATGG + Intronic
974326572 4:60422336-60422358 TTTGAAACACAGAACACTGAAGG + Intergenic
974817723 4:67026896-67026918 TTTGCATCAAAGAAATAGGAAGG + Intergenic
976620134 4:87119030-87119052 TTTTCCACACAGAAAAAGGAGGG + Intronic
977548050 4:98408859-98408881 TTAGGAAAACAGGACTAGGAAGG + Intronic
977977455 4:103283699-103283721 CTTGCACCACAGAATTAGTAAGG - Intergenic
978275930 4:106949793-106949815 TTTGCATCACAGAAATAGTATGG + Intronic
978303010 4:107292452-107292474 TTTGCCACACAGAGATATGAGGG + Intergenic
979677246 4:123423417-123423439 TCTGGAATACAGAGCTAGGAGGG - Intergenic
980688490 4:136260869-136260891 TCTGCAACACTGAACTTGAAAGG + Intergenic
982057319 4:151565043-151565065 TTATCAACACAGTAATAGGAAGG - Intronic
982253078 4:153426594-153426616 TTTGCAAGCCTGAACTTGGAAGG + Intergenic
982546235 4:156736563-156736585 CTTTCAACTCAGAACTGGGAAGG + Intergenic
982584982 4:157224348-157224370 TTTGCTAAAAAGAACTAGGGGGG + Intronic
985888587 5:2699078-2699100 CTGGCAACACAGAGCAAGGATGG + Intergenic
985929804 5:3048089-3048111 GTTTAAACACAGAACTAGGCAGG - Intergenic
995827689 5:116319101-116319123 TCTGCAACAGAGAACTAGCCTGG - Intronic
998164104 5:139832245-139832267 TTTGCAATACAGGATTATGAGGG - Intronic
999587108 5:153101979-153102001 TATGCAAGAAAGAACTCGGAAGG + Intergenic
999822076 5:155238423-155238445 TTTGGAACACAGTAATGGGAGGG - Intergenic
1000424947 5:161079721-161079743 TTTTCAACACAAAATTTGGAAGG - Intergenic
1000812494 5:165880226-165880248 TTTGTAACACAAAACTAAAAGGG - Intergenic
1002942144 6:1726685-1726707 CTTGCAAAACAGATCTAGAAAGG - Intronic
1005060533 6:21773143-21773165 TTTGCAACCCTGAAATAGCACGG - Intergenic
1005431402 6:25761647-25761669 ATGGGAACACAGAACTAGAAAGG + Intronic
1005444993 6:25913515-25913537 ATTGCAATACACAACTGGGAGGG - Intronic
1006177821 6:32133502-32133524 TGAGAAACACAGGACTAGGAAGG + Intergenic
1007019215 6:38502662-38502684 TGCGTAACACAGAAATAGGATGG + Intronic
1007178986 6:39915044-39915066 TTAGCAGGAGAGAACTAGGAGGG - Intronic
1007332844 6:41127437-41127459 TTTACAACACAAAATTAGGATGG - Intergenic
1009953153 6:70419571-70419593 TTTGCTAAACAGAAATAAGATGG - Intronic
1010343040 6:74779841-74779863 TTTCCAACAGCTAACTAGGAAGG - Intergenic
1014567543 6:122968937-122968959 TTTGTTACATAGCACTAGGATGG - Intergenic
1017869766 6:158477271-158477293 TATGAAAAGCAGAACTAGGAGGG + Intronic
1020864252 7:13536935-13536957 TTTACAACACAGATACAGGAGGG + Intergenic
1020967644 7:14891990-14892012 TTTGCCAGACAGAAAAAGGAAGG + Intronic
1021500518 7:21328353-21328375 TCTGCCACACAGAAAAAGGAGGG + Intergenic
1028512033 7:91635832-91635854 TTTGCAACACAAAGAAAGGATGG + Intergenic
1030133122 7:106219954-106219976 TCTAAATCACAGAACTAGGAGGG - Intergenic
1038094706 8:24295099-24295121 TTAGCAACAAAGTACTAAGAGGG - Intronic
1039132678 8:34285347-34285369 TTTGCAACACAGATGCAAGAAGG + Intergenic
1041048918 8:53914311-53914333 TTGGCATCAAAGAACTAAGAAGG - Intronic
1041576760 8:59406156-59406178 TCTGCAACACGGAGCTATGAGGG + Intergenic
1043238982 8:77907125-77907147 TTTGTAAGACAAAAGTAGGAAGG + Intergenic
1044422462 8:92013470-92013492 TTTGCAAAACACAACTGGTATGG + Intronic
1044848519 8:96405584-96405606 TTAGCAGCACAGAAGCAGGAGGG + Intergenic
1045656079 8:104387895-104387917 TTTACACCACAGAAATAGGCAGG - Intronic
1047417902 8:124680643-124680665 TTTGCAAGACATAACTATCATGG - Intronic
1048818656 8:138358775-138358797 TTTACAGCACAAAACTAGAAAGG + Intronic
1054709406 9:68496373-68496395 GTTGCAGCACAGAACTAGGCTGG + Intronic
1058201165 9:102042746-102042768 TTTGGAACACAGTCCAAGGAAGG + Intergenic
1058407406 9:104692086-104692108 TATGCAACAGGGAGCTAGGAGGG + Intergenic
1061519409 9:131108948-131108970 TTTGCAACAATAGACTAGGAAGG + Intronic
1186772341 X:12830401-12830423 TCAGCAACACAGAAGTATGATGG + Intergenic
1186849550 X:13567300-13567322 TTTGTAACTCAGGACTAAGAAGG + Intergenic
1187002279 X:15194594-15194616 TTTGCACAACAGAACCAGAAAGG + Intergenic
1188588159 X:31802044-31802066 TAAGCAAAACAAAACTAGGAGGG + Intronic
1188683628 X:33042862-33042884 TCTGAAACACACAACTTGGATGG + Intronic
1198337400 X:135679928-135679950 TTAGAAACACAGAGCTAAGAAGG + Intergenic
1198361791 X:135902885-135902907 TTAGAAACACAGAGCTAAGAAGG - Intronic
1199917000 X:152353908-152353930 TTTGTAACACAGAACAGGGATGG - Intronic