ID: 1090962417

View in Genome Browser
Species Human (GRCh38)
Location 11:131568855-131568877
Sequence GGAGCTATTAAGTATACAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 113}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090962417 Original CRISPR GGAGCTATTAAGTATACAGC TGG (reversed) Intronic
902904959 1:19549676-19549698 GGAGTTGTGCAGTATACAGCTGG + Intergenic
906421567 1:45672574-45672596 GGAGATGTTAAGTAGATAGCTGG + Intronic
907730465 1:57060857-57060879 GGAGCTATTAAGCATGGAGATGG + Intronic
908504127 1:64777909-64777931 GGAGCTATTGGGTAGACAGTTGG + Exonic
908617971 1:65944705-65944727 GAAGCAATTAAGCATACTGCAGG + Intronic
910662649 1:89690050-89690072 GGAGATATTAAGTAATCAGTTGG + Intronic
911526920 1:98999235-98999257 GGAGCTAACACGTATACAGCTGG + Intronic
911934851 1:103957221-103957243 GGAGCTATTGAGGATAAAGAAGG - Intergenic
918473826 1:184902622-184902644 GCAGCTCTTCTGTATACAGCAGG - Intronic
920196356 1:204229861-204229883 ACAGCTATTAAGTACAGAGCTGG - Intronic
922136686 1:222834921-222834943 TGCAGTATTAAGTATACAGCAGG + Intergenic
922442658 1:225669265-225669287 GGGACTATTATGTATACAGTTGG + Intergenic
1067795583 10:49319069-49319091 GGTGCTGTTAAGTGTTCAGCTGG - Intronic
1068343652 10:55741877-55741899 GGTGCTATTAAATATTCATCAGG - Intergenic
1077516193 11:3003452-3003474 GGAGCTATCAGGTAGGCAGCTGG + Intronic
1077715638 11:4577390-4577412 GGAGCTACACAGTTTACAGCTGG + Intronic
1081707905 11:45196320-45196342 GGAGCTGTTAAGTACACAACCGG - Intronic
1082063017 11:47876599-47876621 GGAGATATCAAGTAGACATCTGG + Intergenic
1083363372 11:62126779-62126801 AGAGATATAAAGTATACAGGAGG - Intronic
1087213498 11:95469147-95469169 GGGGCTGTTAACTATAAAGCTGG + Intergenic
1089153348 11:116382158-116382180 GTAGATATTGAGAATACAGCCGG + Intergenic
1090962417 11:131568855-131568877 GGAGCTATTAAGTATACAGCTGG - Intronic
1092979201 12:13776967-13776989 GGAGAGATTAATAATACAGCGGG + Intronic
1096188902 12:49601794-49601816 GGACCTACTATGTATAGAGCTGG + Intronic
1096322732 12:50629620-50629642 GGAGATGTTAAGTATGCAGTTGG - Intronic
1097573323 12:61359016-61359038 GGTCCCATTAAATATACAGCAGG + Intergenic
1099285093 12:80707593-80707615 GGAGCTACTATATATAAAGCTGG + Exonic
1101769296 12:107733688-107733710 GCAGCTAGTAAGTTTAAAGCAGG - Exonic
1101893583 12:108736951-108736973 GGAGCTATTATGAATAAAGCTGG + Intergenic
1103941297 12:124502689-124502711 GGAGCTAGGAAGGACACAGCTGG + Intronic
1103967826 12:124651439-124651461 GAAGCTATTAAGTTTTAAGCAGG - Intergenic
1108022126 13:46138308-46138330 AGATCTATTAAATTTACAGCTGG - Intronic
1111211025 13:85080639-85080661 GGGGCGATTAAGGTTACAGCTGG + Intergenic
1114881778 14:26795284-26795306 GGAGATATCAAGTATGCAGTTGG + Intergenic
1115729320 14:36251170-36251192 ACAGCTCTTAAGTATACTGCTGG - Intergenic
1115954247 14:38760113-38760135 GGAGATCTTAATTATAAAGCAGG - Intergenic
1117915851 14:60677109-60677131 GGACCTATTAAGTACAGAACAGG - Intergenic
1119956125 14:78800197-78800219 AGGACTGTTAAGTATACAGCTGG + Intronic
1121201145 14:92119427-92119449 ATAGCTATTAAGTACAGAGCTGG + Intronic
1121406416 14:93721794-93721816 GGAGCTATTAATGATGAAGCAGG + Intronic
1122311839 14:100802312-100802334 GGAGCTATTACAAATAAAGCCGG - Intergenic
1130519627 15:84652449-84652471 GGAGCGATTAAGGATATAGAGGG - Intronic
1130800986 15:87262924-87262946 GGAGCTATTCAGTAGATAGTTGG - Intergenic
1133618374 16:7501548-7501570 GGACCTATAAAATATAGAGCTGG - Intronic
1135930669 16:26733548-26733570 ATAGCTATAAAGTTTACAGCAGG + Intergenic
1137306895 16:47209977-47209999 AGGGCTATTATGAATACAGCTGG + Intronic
1140746974 16:77989083-77989105 CCAGCTAGTAACTATACAGCTGG - Intergenic
1147011824 17:37455827-37455849 ACAGCTGTTAAGTACACAGCAGG - Intronic
1151811266 17:76443685-76443707 GGAGCTATCAAGTAAGCAGCTGG + Intronic
1153006419 18:501447-501469 GGCTTTATTAAGTATACAGCAGG - Intergenic
1156755569 18:40520440-40520462 GTAGCAGTTAAGTAGACAGCTGG - Intergenic
1158830621 18:61273952-61273974 GGAGCTTTGTAGTATAAAGCAGG + Intergenic
1168589041 19:57617591-57617613 GGAGGTGTCAAGTAGACAGCTGG + Intronic
1168607727 19:57773122-57773144 GGAGCTATTAAATGGGCAGCTGG + Intronic
927347946 2:22069594-22069616 GGAGCCATGAGGTGTACAGCCGG - Intergenic
928888212 2:36174357-36174379 AGGTCTATTAAGTATATAGCAGG - Intergenic
931552581 2:63462929-63462951 GGAGACATTAAGTAGTCAGCTGG + Intronic
931958960 2:67460460-67460482 GGAGCTTTAAAATATGCAGCAGG - Intergenic
932017804 2:68050796-68050818 AGAGATATTGAGTATGCAGCTGG - Intronic
937441271 2:121918137-121918159 GGAGCCAATAAGGACACAGCAGG - Intergenic
938865774 2:135418552-135418574 GGAGCTATTAAGTTTGGATCTGG + Intronic
940673717 2:156703276-156703298 GGAGCTATTAATTTTACAAATGG - Intergenic
941541226 2:166787520-166787542 TGAGCTACTAAGTATGCACCAGG - Intergenic
943525684 2:189014373-189014395 GGAGCAATTAAGGTTGCAGCAGG - Intergenic
944037538 2:195313555-195313577 GCAACTACTAAGTAAACAGCTGG + Intergenic
946079745 2:217107182-217107204 GTAGCTATTCAGATTACAGCCGG + Intergenic
947010173 2:225557165-225557187 GTGGCTATTAAGTAGACAGATGG - Intronic
947019236 2:225656326-225656348 ACAGCTATTAAGTATACAGAAGG - Intergenic
1168917960 20:1506740-1506762 GGAGCTGTTGAGTAGACAGATGG + Intergenic
1174980397 20:55387865-55387887 GGTGCTACTAAATATTCAGCAGG + Intergenic
1175235798 20:57510254-57510276 AGAGCTTTTATGTATACAGGTGG + Intronic
1175456896 20:59122282-59122304 GGAGCTATAAAGTGAACAACAGG + Intergenic
1178133450 21:29599688-29599710 GGAGCTTTTATGCAGACAGCAGG - Intronic
1185263134 22:49882018-49882040 GGAGCTATTAATAATACTGCTGG - Intronic
951389107 3:22081282-22081304 GGAGCTATATAGTATAGAACTGG + Intronic
953985245 3:47437136-47437158 TGAGCTATTAAGAATAAAGTTGG + Intronic
955701149 3:61683496-61683518 GGAGCTGTTAAGTGTAGAGAGGG - Intronic
956087793 3:65631652-65631674 GGAGCTATTTAAAATAAAGCTGG - Intronic
956132366 3:66066428-66066450 TGGGCTATTAAGTATTCAGAGGG - Intergenic
957885380 3:86281477-86281499 GCAGCTATTAGGTAGACAACTGG - Intergenic
965420210 3:168448595-168448617 GGAGCTATTCAGTGGACAGTAGG - Intergenic
967835732 3:193960818-193960840 GGAGCTAGTATGTATGGAGCAGG + Intergenic
970424758 4:15935857-15935879 AGAGCTTTAAAGTATACAGAGGG + Exonic
979532057 4:121779469-121779491 TGAGCAATGAAGCATACAGCTGG - Intergenic
981661643 4:147174410-147174432 TGAAATATGAAGTATACAGCTGG + Intergenic
982375760 4:154688945-154688967 GGAGTTGCTAAGTACACAGCTGG - Intronic
982711549 4:158763002-158763024 GGAGATATTAAGTAGGTAGCTGG + Intergenic
985192423 4:187390195-187390217 GGAGCTATCAAGGGGACAGCTGG + Intergenic
986472777 5:8092465-8092487 GGAGGTATTAAGGATACAAAAGG + Intergenic
990451468 5:55934848-55934870 ACAACTATTAAGTATACATCTGG - Intergenic
990673406 5:58157905-58157927 GGAGGCATTAAGGATACACCTGG - Intergenic
990894611 5:60685213-60685235 TGAGCTAATGAGTGTACAGCCGG - Intronic
991224375 5:64252625-64252647 CCAGCTGTTAAGTATACAGATGG + Intronic
992320509 5:75608968-75608990 GAAGCTATGAAGTATACTGTGGG - Intergenic
997168055 5:131683277-131683299 GGTGGTTTTAAGTATACAGGAGG - Intronic
997874027 5:137532404-137532426 GGAGCTATTAAGCAGGCAGTGGG - Intronic
1002255112 5:177952796-177952818 GGAGCTATAAAGCTTGCAGCAGG - Intergenic
1012444395 6:99293236-99293258 GGAGGAATGAAGGATACAGCTGG - Intronic
1013548368 6:111182628-111182650 GGAGATGTTAAGTAAGCAGCTGG - Intronic
1022483645 7:30760759-30760781 GTAGCTATTAAGTAGAGAGCTGG + Intronic
1023587226 7:41743339-41743361 GGAGCTATGAAGAATAAAGCAGG + Intergenic
1023791567 7:43757761-43757783 GGAGGTATTAAGGAGGCAGCTGG + Intergenic
1023978583 7:45052228-45052250 GGAGTTCTGAAGTATTCAGCTGG + Intronic
1025212998 7:57031704-57031726 GGAGCCATTCACTATACAGCAGG - Intergenic
1025658955 7:63545120-63545142 GGAGCCATTCACTATACAGCAGG + Intergenic
1028754075 7:94414781-94414803 GGACATATTAAGGAGACAGCTGG + Intronic
1029676119 7:102070109-102070131 GGAGCCATTCACTATACAGCAGG - Intronic
1029907921 7:104110941-104110963 GGACTTATTAAGAACACAGCAGG - Intergenic
1032577493 7:133071042-133071064 GGAGATATCAAGTAGGCAGCTGG + Intronic
1033435634 7:141331126-141331148 GGAGCTATTAAGTAGGCAAGTGG + Intronic
1035177584 7:157062931-157062953 GGAGCTATTACAAATATAGCTGG - Intergenic
1041684137 8:60627039-60627061 GGTGATTTAAAGTATACAGCAGG + Intergenic
1042699731 8:71599219-71599241 GGAGCAATTAAGTACAGGGCTGG + Intergenic
1042842689 8:73139979-73140001 GGAGGCATTAAGCATACAGGAGG - Intergenic
1043208369 8:77476692-77476714 GGGGCTATTATGAATAAAGCTGG - Intergenic
1044879162 8:96704873-96704895 GGAGGTATTAAGTAGACAATTGG + Intronic
1047326161 8:123837942-123837964 GTAGCTATTTAGTTTTCAGCTGG + Intergenic
1051369467 9:16345934-16345956 AGAGCTACTCAGTACACAGCTGG - Intergenic
1058568460 9:106312904-106312926 GTAGCTATTAAATATATAGGAGG + Intergenic
1059189788 9:112314060-112314082 GGTGATTTAAAGTATACAGCAGG + Intronic
1059393018 9:114011114-114011136 GCAGCTATTAAGTGTCGAGCTGG - Intronic
1187303515 X:18074330-18074352 GGGGCTATTATGTAGACAGTAGG + Intergenic
1189637435 X:43026161-43026183 GGAGCTATTAATAATTAAGCTGG - Intergenic
1189906047 X:45760669-45760691 GGAACTCATAAGTATACGGCAGG - Intergenic
1196423752 X:115548912-115548934 AGAGTTATTAATTAGACAGCAGG + Intergenic
1197712362 X:129680463-129680485 GGAGCTGTCAAGTATGCAGTTGG + Intergenic