ID: 1090962749

View in Genome Browser
Species Human (GRCh38)
Location 11:131571858-131571880
Sequence TTGGTAATATGGGCTTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 213}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090962742_1090962749 -2 Left 1090962742 11:131571837-131571859 CCTCAGCACAGAGACTCCTTTTT 0: 1
1: 0
2: 1
3: 31
4: 358
Right 1090962749 11:131571858-131571880 TTGGTAATATGGGCTTTGGGAGG 0: 1
1: 0
2: 3
3: 20
4: 213
1090962741_1090962749 24 Left 1090962741 11:131571811-131571833 CCTTTCAGAACTAGGTCACAAGT 0: 1
1: 0
2: 1
3: 14
4: 79
Right 1090962749 11:131571858-131571880 TTGGTAATATGGGCTTTGGGAGG 0: 1
1: 0
2: 3
3: 20
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090962749 Original CRISPR TTGGTAATATGGGCTTTGGG AGG Intronic
904611511 1:31728422-31728444 TTGGTGCTATGGGCTTGGGCAGG + Intronic
905545412 1:38794470-38794492 TTGGAAATGGGGCCTTTGGGAGG - Intergenic
906700664 1:47855686-47855708 TTGGAGATGGGGGCTTTGGGAGG + Intronic
907355796 1:53872948-53872970 TTGGCTATAGGGGCTTTGTGGGG - Intronic
909440314 1:75689314-75689336 TTGGAAATCTGGGCCTTGGATGG - Intergenic
910165412 1:84322633-84322655 CTGGTTATTTTGGCTTTGGGGGG + Intronic
911293220 1:96082613-96082635 TTGGTAATGTGGCCATTGGCTGG + Intergenic
913157577 1:116115020-116115042 TTACAAATATGGGCTTTGGAAGG + Intronic
913614449 1:120543731-120543753 TTTGTAATATGAACTTTGTGAGG - Intergenic
914294705 1:146309196-146309218 TTAGTAATATGGGAGGTGGGGGG + Intergenic
914575821 1:148967170-148967192 TTTGTAATATGAACTTTGTGAGG + Intronic
915982944 1:160433430-160433452 TTGGAAATGCGGCCTTTGGGAGG - Intergenic
916854521 1:168736373-168736395 TTGGAAATAGAGGCTTTGAGAGG + Intergenic
917475992 1:175369548-175369570 TTGGAAATAAGGGTTTGGGGTGG + Intronic
919892592 1:201986482-201986504 TTGGGATTATGGGTTTTGAGGGG + Intronic
920036130 1:203066973-203066995 TTGGGAGTATGGGCTAGGGGTGG + Intronic
920041968 1:203103915-203103937 TTGGAAATAAGGCCTTTGAGAGG + Intronic
920944292 1:210514081-210514103 TTGGTAAGATGCTCTTTGAGAGG + Intronic
922202641 1:223419283-223419305 TTTCTATTTTGGGCTTTGGGTGG - Intergenic
924013473 1:239693304-239693326 TTGGAGATATGGGTTTTAGGAGG + Intronic
924047526 1:240047171-240047193 TTGGAAGTAGGGCCTTTGGGAGG + Intronic
924745923 1:246833644-246833666 TTGGGAATATGGGCTTTGATTGG - Intergenic
1062964882 10:1599503-1599525 TTGGAAATATGGGTTTGGGGAGG + Intronic
1063034031 10:2267541-2267563 TTGGGAGTGGGGGCTTTGGGGGG + Intergenic
1064215763 10:13399149-13399171 TTGGGGTTATGGGTTTTGGGAGG + Intergenic
1064269141 10:13849423-13849445 TTGGCAACATGCACTTTGGGGGG + Intronic
1065719414 10:28611649-28611671 TGGGTAATATGGGGGTGGGGGGG + Intronic
1070454596 10:76600146-76600168 TTGGAAGTAAGGCCTTTGGGAGG + Intergenic
1077147877 11:1053982-1054004 TTGGGACTAAGGGGTTTGGGTGG - Intergenic
1078308179 11:10212079-10212101 TTGGTAAAAAGAACTTTGGGAGG + Intronic
1079205306 11:18409833-18409855 TTGGCAACATGGGCTTTAGTGGG - Intergenic
1079267464 11:18947820-18947842 TTGGTAATATGGGCTCTTTTTGG - Intergenic
1081371851 11:42313799-42313821 TTGGAAATATAGACTTTTGGGGG + Intergenic
1081743238 11:45455493-45455515 TTGCTGCTATGGGATTTGGGTGG - Intergenic
1085608136 11:77921629-77921651 TTGGTAATTGGGGGTGTGGGTGG - Intronic
1086371860 11:86163072-86163094 ATGGTAATGTGGGCTTTGCAGGG + Intergenic
1089081563 11:115780531-115780553 ATGGGATTATGGGTTTTGGGAGG + Intergenic
1090102826 11:123818897-123818919 TTGGAAATGAGGCCTTTGGGAGG - Intergenic
1090962749 11:131571858-131571880 TTGGTAATATGGGCTTTGGGAGG + Intronic
1092349574 12:7745159-7745181 TTGAAGATAGGGGCTTTGGGAGG + Intronic
1092406346 12:8224381-8224403 TCCGTCACATGGGCTTTGGGAGG - Intronic
1092710265 12:11329083-11329105 TTGGGTTTATGTGCTTTGGGTGG + Intergenic
1093090647 12:14916406-14916428 TTGGCAAAATGGGCTTTTGGTGG + Intronic
1094101770 12:26771819-26771841 TTTGTTTTTTGGGCTTTGGGGGG + Intronic
1094820754 12:34222362-34222384 TTGGCAATTTTGGGTTTGGGGGG + Intergenic
1095104481 12:38215606-38215628 TTGGGCATAGGGTCTTTGGGAGG + Intergenic
1097299295 12:58001123-58001145 TTGTTCATATGTGCTTTTGGGGG + Intergenic
1097327296 12:58291487-58291509 TTTGTATTATTGGCTTTGGCTGG + Intergenic
1097597658 12:61654090-61654112 TTGGTATTAAGGGCCTTGGGAGG + Intergenic
1098935609 12:76475371-76475393 TTGCTAATCTAGACTTTGGGAGG - Intronic
1099085542 12:78242130-78242152 CTGGGTATATGTGCTTTGGGCGG + Intergenic
1099348235 12:81530206-81530228 TTGATATTTTGAGCTTTGGGAGG - Intronic
1099741891 12:86648406-86648428 TTGGTGATGGGGCCTTTGGGAGG + Intronic
1100062973 12:90604364-90604386 GTGGAAATATGAGATTTGGGAGG + Intergenic
1100406276 12:94275324-94275346 CTGGTTAAATGGGCTTTGGTGGG + Intronic
1100767571 12:97884694-97884716 TTGGAGATAGGGCCTTTGGGAGG - Intergenic
1100803975 12:98261989-98262011 GTGGGAATATGGGCTCCGGGGGG - Intergenic
1102791393 12:115649364-115649386 TTGGTAAGATGAGCTCTAGGTGG - Intergenic
1104101478 12:125616779-125616801 TTGGAGATGTGGCCTTTGGGAGG + Intronic
1104258224 12:127158686-127158708 TTCATTATATGGGTTTTGGGGGG - Intergenic
1106339038 13:28810530-28810552 TTGGAAATAAGGCCTTTGGGAGG + Intergenic
1106374194 13:29168734-29168756 CTGGTACTAAGGGCTTCGGGTGG - Intronic
1106898362 13:34329623-34329645 GTGGGATTATGGGTTTTGGGAGG + Intergenic
1109643704 13:65224893-65224915 TAGGAAATAGGGCCTTTGGGAGG + Intergenic
1109926331 13:69144903-69144925 TTGATTATGTGGGCTTTGGATGG + Intergenic
1112393683 13:99008863-99008885 TTGGCAATAGGGTCTTTAGGAGG - Intronic
1112516595 13:100058632-100058654 TTGCAAATATGTGCTTTGGTTGG + Intergenic
1115205277 14:30896950-30896972 ATGGTAATATATGCTTTGGATGG + Intronic
1117193330 14:53315768-53315790 GAGGTAATGTGGTCTTTGGGGGG + Intergenic
1119267909 14:73275488-73275510 TTTGTAATATGGGTCTTGGTGGG - Exonic
1119598235 14:75956221-75956243 TGGGAAATAAGGGGTTTGGGAGG + Intronic
1119724145 14:76911881-76911903 TTGGAGATAGGGCCTTTGGGAGG + Intergenic
1119910011 14:78341130-78341152 TTGGTAATAGTGGCTTTCCGAGG + Intronic
1119988385 14:79166639-79166661 TTAGTAAGATGGGCATTGGCAGG + Intronic
1120886069 14:89452621-89452643 ATAGTAAGATGGGCCTTGGGAGG + Intronic
1122245898 14:100403343-100403365 TTGGCCATATGTGCTTTGGTTGG - Intronic
1124926427 15:34074710-34074732 TTGGAAATAGGGTCTTTAGGAGG - Intergenic
1126674402 15:51146905-51146927 TTGGAAATGTGGGCTTGGGTGGG + Intergenic
1129903194 15:79167434-79167456 TTGGAGATAGGGCCTTTGGGAGG - Intergenic
1130317271 15:82807492-82807514 TTGGAAATGTGGCCTTTGGGAGG + Intergenic
1131216243 15:90537914-90537936 TCGGAAATAGGTGCTTTGGGAGG + Intronic
1131352001 15:91709444-91709466 TTGGAAATTGGGCCTTTGGGAGG + Intergenic
1131659982 15:94503936-94503958 TTGGTGTTAGGGCCTTTGGGAGG - Intergenic
1133048525 16:3102846-3102868 TTGTTGATTTGGGATTTGGGAGG + Intergenic
1134088363 16:11373959-11373981 TTGAAAATATGGGGTTTAGGTGG + Intronic
1135149393 16:19992251-19992273 TTGGAGGTAAGGGCTTTGGGAGG + Intergenic
1135472639 16:22745135-22745157 TTGGAAGTAGGGCCTTTGGGAGG + Intergenic
1135682693 16:24471917-24471939 TTGGGGATAAGGGCTTTGGGTGG - Intergenic
1135751714 16:25063663-25063685 TTTATAATTTGGGCTTTGGCTGG + Intergenic
1136107231 16:28038564-28038586 TTGGTACTACGGGCGGTGGGGGG + Intronic
1140026294 16:71293224-71293246 TTGGAAATGGGGCCTTTGGGAGG - Intergenic
1140265919 16:73420541-73420563 TTGGCAATATGCGCTTTGTTTGG - Intergenic
1140393081 16:74605192-74605214 TTGGAAATGGGGGTTTTGGGGGG - Intronic
1140596404 16:76419951-76419973 TTGGAAATGAGGTCTTTGGGAGG - Intronic
1142491927 17:285001-285023 TTGGAGATGGGGGCTTTGGGAGG - Intronic
1146297243 17:31659495-31659517 TTGGAAATACGGTCTTTAGGAGG - Intergenic
1147353971 17:39876213-39876235 TTAGAAATTTGGGCTTTGGCTGG - Intronic
1149047574 17:52265708-52265730 GTGGTAAGATGGGATTTTGGAGG - Intergenic
1153220145 18:2853998-2854020 TTAGTATTGGGGGCTTTGGGAGG + Intronic
1154395497 18:13984066-13984088 ATGCTAAGATGGGCTTTGGAAGG + Intergenic
1155324585 18:24652933-24652955 TTTGTAACTTGGGTTTTGGGAGG + Intergenic
1163058120 19:14737615-14737637 TTGGTAACTTGGGGTTTAGGAGG - Intronic
1163811394 19:19434648-19434670 TTGGGAATCTGGGATTTGGCTGG + Intronic
1164413199 19:28022431-28022453 TGGCTAACATGGGGTTTGGGTGG + Intergenic
1165730026 19:38139360-38139382 TTGTTAATATGGGCTCTGGGTGG - Intronic
1168191046 19:54739162-54739184 GTGGAGATATGGGCTTAGGGTGG + Intronic
1168191072 19:54739257-54739279 TTGGCGATATGGGCCTAGGGTGG + Intronic
1168191082 19:54739295-54739317 GTGGAGATATGGGCTTGGGGTGG + Intronic
1168193234 19:54755463-54755485 GTGGAGATATGGGCTTGGGGTGG + Intronic
1168193263 19:54755559-54755581 GTGGAGATATGGGCTTGGGGTGG + Intronic
1168195390 19:54770580-54770602 TTGGCGATATGGGCTTAGGGTGG + Intronic
1168203786 19:54834867-54834889 GTGGAGATATGGGCTTGGGGTGG + Intronic
926746182 2:16160267-16160289 TTTGTATTATGAGCTTTTGGTGG - Intergenic
926758179 2:16252578-16252600 TTGGGCAGATTGGCTTTGGGCGG - Intergenic
929613656 2:43291097-43291119 TTGGGCATATGTGTTTTGGGGGG + Intronic
932076089 2:68664209-68664231 TTAGAAATATTAGCTTTGGGAGG + Intergenic
934911416 2:98258711-98258733 TTGGTACTAGTGGCTTTGTGGGG + Intronic
935202945 2:100874239-100874261 TTGGTTATATATACTTTGGGAGG - Intronic
935382463 2:102466428-102466450 TTGGTGATAGGGTCTTTAGGAGG + Intergenic
937436671 2:121887242-121887264 TGGGTGATTTGGGCTTTGAGTGG - Intergenic
940056664 2:149520336-149520358 TGGGAGATATGGGCTTTGGGAGG + Intergenic
940066116 2:149632087-149632109 TGGATAATAAGGTCTTTGGGGGG - Intergenic
940622076 2:156124977-156124999 TTGGTAAGATGGGGTGGGGGAGG - Intergenic
943294728 2:186122768-186122790 GTGGTAATAGGGGCTGAGGGAGG - Intergenic
944076133 2:195733193-195733215 TTGGTGATTTGGGTTTAGGGAGG - Intronic
945567160 2:211414773-211414795 TTAGAAATATGGCCTTTGTGTGG + Intronic
945841846 2:214896158-214896180 TTGATAATATTGCATTTGGGTGG + Intergenic
1171144048 20:22766444-22766466 CTGTTCATATGGGTTTTGGGTGG - Intergenic
1173420943 20:42900574-42900596 TATGTGATATGGGCTCTGGGTGG - Intronic
1173955343 20:47027999-47028021 TTGGTGATGAGGCCTTTGGGAGG + Intronic
1174271936 20:49375950-49375972 TTGGAACTATGTGCTTTTGGGGG + Intronic
1178186067 21:30222277-30222299 TTTCTAATAAGGGCGTTGGGAGG - Intergenic
1179141641 21:38731133-38731155 TTGGTACTGGGAGCTTTGGGAGG - Intergenic
1179429891 21:41314069-41314091 TTGGAGATAGGGCCTTTGGGAGG + Intronic
1182924817 22:34112187-34112209 TTGGAAATAAGGTCTTTAGGAGG - Intergenic
1182963304 22:34497138-34497160 TTGGAGATAGGGCCTTTGGGAGG + Intergenic
1183224950 22:36543307-36543329 TTGGAAGTAGGGGCTTTGGCTGG + Intergenic
953464789 3:43110076-43110098 TTGGAGATATGGCCTTTGAGAGG - Intergenic
955690425 3:61585410-61585432 TTGGTACTATAGCCATTGGGTGG + Intronic
956192861 3:66623602-66623624 TTGGAGATAGGGCCTTTGGGAGG - Intergenic
956722827 3:72133462-72133484 TTGGGAATGTGGGCTGTGGCTGG - Intergenic
956793783 3:72700332-72700354 TTGGGAGTATGGGCTCTGGACGG + Intergenic
961415665 3:126754833-126754855 TTGGTGCTTTGGCCTTTGGGAGG + Intronic
962006892 3:131358822-131358844 TTGGAAGTAGGGCCTTTGGGAGG + Intergenic
963665784 3:148184354-148184376 CTGGAAATTTGGGCTTTCGGTGG - Intergenic
964665691 3:159169584-159169606 TTAGGAACATGGGCTTTGGCAGG - Intronic
965040866 3:163505309-163505331 TTGGAAATGTAGCCTTTGGGAGG - Intergenic
966774220 3:183529837-183529859 TTGGAAATAGGGGTTTTAGGAGG + Intronic
967825628 3:193875079-193875101 GTGGTGATAGGGGCTTGGGGTGG + Intergenic
969433556 4:7170366-7170388 TTGGAAATGGGGCCTTTGGGAGG - Intergenic
969759784 4:9173602-9173624 TCCGTCACATGGGCTTTGGGAGG + Intronic
972953938 4:44366263-44366285 ATGTTAACATGGGATTTGGGTGG - Intronic
976188596 4:82467812-82467834 TTGGAGATAAGGCCTTTGGGAGG + Intergenic
976226063 4:82796775-82796797 TGGGCAATAAGGGCTTTGGTTGG + Intronic
977487110 4:97663246-97663268 TTGTTAATATGAGCTTGGGCTGG + Intronic
977756122 4:100674416-100674438 TTGGAGATACGGCCTTTGGGAGG - Intronic
980371401 4:131878482-131878504 TTGGAGATGTGGGCTTTTGGAGG + Intergenic
983317275 4:166148544-166148566 TTGGTAATATCTGGTGTGGGTGG + Intergenic
983486295 4:168334690-168334712 TAGGTAATATGGGTCTTGTGGGG + Intergenic
984449943 4:179886964-179886986 TTGGTTATATGAGCTTTTTGGGG - Intergenic
985638664 5:1052914-1052936 TTGGGAATTTGTGCTTTGGAAGG - Intronic
986546132 5:8899420-8899442 TTGGGATTATGGGCTTTTGGGGG - Intergenic
988735262 5:34014139-34014161 TTGGTGATGGGGCCTTTGGGAGG - Intronic
989496967 5:42120761-42120783 TTGGAAATATGGGCTTAGTGTGG - Intergenic
991228308 5:64298999-64299021 TTGTTAGTATGGCCTTTGGTAGG + Intronic
991265851 5:64716502-64716524 TAGTTAATAAGTGCTTTGGGGGG + Intronic
992207924 5:74449022-74449044 TTGGAGATGTGGCCTTTGGGAGG - Intergenic
993300128 5:86198372-86198394 TTGATCATATGGGATTTGGGAGG + Intergenic
993705923 5:91170363-91170385 TTAGTCATAAGGGCTTTGTGTGG + Intergenic
997331111 5:133062518-133062540 AGGGTAATATGGGCTTTGAGAGG + Intronic
997676497 5:135716966-135716988 TATGTACTATGGGCCTTGGGAGG + Intergenic
998245274 5:140496386-140496408 TTAGTTATAAGGGTTTTGGGAGG + Intronic
999413638 5:151375530-151375552 TTGGCTATTTGGGCTTTTGGGGG + Intergenic
1001030447 5:168258744-168258766 TGGGTATGAGGGGCTTTGGGAGG + Intronic
1004197085 6:13514953-13514975 TTGGAAATGAGGTCTTTGGGAGG - Intergenic
1004851407 6:19703378-19703400 TTAATAATATTGGCTTTGGCCGG + Intergenic
1004999409 6:21225437-21225459 TTGGTAGTAAGTGCTGTGGGAGG + Intronic
1008165398 6:48132153-48132175 TTGGAGATAGGGCCTTTGGGAGG - Intergenic
1009671270 6:66753997-66754019 TTGGAAATGTGGTCTTTGGGAGG - Intergenic
1009785231 6:68328608-68328630 TTGGTGATGAGGTCTTTGGGAGG - Intergenic
1009947641 6:70358222-70358244 TTGGAGATATGGCCTTTGGGAGG + Intergenic
1010580045 6:77584957-77584979 TTGGAGATAGGGGCTTGGGGAGG - Intergenic
1011084989 6:83529773-83529795 TTGGAAATGGGGCCTTTGGGAGG - Intergenic
1011841793 6:91510147-91510169 GAGGTAATTTGGGCTTTGCGAGG - Intergenic
1012242637 6:96891511-96891533 TTGGTGACATGAGATTTGGGTGG - Intronic
1012842826 6:104351809-104351831 TGGGCAAGATGGGCTTTGAGGGG - Intergenic
1017029349 6:150207173-150207195 TTTTTAAAAAGGGCTTTGGGAGG + Intronic
1019695209 7:2442058-2442080 TTGGTGCCAGGGGCTTTGGGGGG - Intergenic
1020428407 7:8095199-8095221 TTGCAAATAGGGCCTTTGGGAGG - Intergenic
1024030354 7:45455378-45455400 TTGGGAAAATGGGCTGGGGGTGG - Intergenic
1024039449 7:45540209-45540231 TTGGTAATTTGTGCTTTAGGTGG - Intergenic
1025844767 7:65186212-65186234 TTGGTAATTGGGGGTGTGGGTGG + Intergenic
1025895095 7:65692545-65692567 TTGGTAATTGGGGGTGTGGGTGG + Intergenic
1028304098 7:89240347-89240369 TTGGTTATGTGAGCTTTGCGTGG + Intronic
1028559911 7:92163255-92163277 CTGGTATTGTGGGCTTTGTGGGG - Intronic
1028672253 7:93415655-93415677 TTGGTTATTTGGGGTTTTGGGGG - Intergenic
1031910037 7:127506326-127506348 TTAAAAATAAGGGCTTTGGGAGG + Intergenic
1032066078 7:128772314-128772336 TTGTTGAAATGGCCTTTGGGTGG + Intergenic
1032608712 7:133387954-133387976 TGGGGGAGATGGGCTTTGGGGGG + Intronic
1036846724 8:12175320-12175342 TCCGTCACATGGGCTTTGGGAGG - Intergenic
1036868089 8:12417639-12417661 TCTGTCACATGGGCTTTGGGAGG - Intergenic
1041562672 8:59237735-59237757 TGGGTAAAATGGGCTGTTGGTGG - Intergenic
1043807079 8:84685104-84685126 TTGGAAATGGGGCCTTTGGGAGG - Intronic
1044297444 8:90545271-90545293 TTGGACATATGGCCTTTGGGAGG - Intergenic
1044745445 8:95366427-95366449 TTGGAGATAGGGCCTTTGGGTGG - Intergenic
1044845096 8:96372573-96372595 TTGGTGGTAAGGGCTTTGAGTGG - Intergenic
1045711094 8:104985001-104985023 CTGGGAACATGGTCTTTGGGTGG + Intronic
1046083258 8:109398512-109398534 TTGAGAATATGAGGTTTGGGGGG - Exonic
1046360084 8:113141101-113141123 TTGGTAATTTGTGCTTTTTGAGG - Intronic
1047075264 8:121394043-121394065 TTGGATATAGGGCCTTTGGGAGG - Intergenic
1047767560 8:128001917-128001939 TTGGAGGTAGGGGCTTTGGGAGG - Intergenic
1047829980 8:128618505-128618527 TTGGTAACCTGGGCCCTGGGTGG + Intergenic
1048056284 8:130869290-130869312 TTAATAATATGGGCTTTCTGTGG - Intronic
1048242197 8:132753667-132753689 TTGGAATTATGGGCTTAGAGGGG - Intronic
1049291183 8:141803121-141803143 TTGGGGCTATGGGTTTTGGGAGG + Intergenic
1050745041 9:8866340-8866362 TTAGAAAGATGGGCTTTTGGTGG - Intronic
1052389017 9:27856239-27856261 TTGGGAGTATGGGCACTGGGTGG + Intergenic
1053543367 9:38997662-38997684 TTAGAAATTTGGCCTTTGGGGGG + Intergenic
1053807798 9:41821170-41821192 TTAGAAATTTGGCCTTTGGGGGG + Intergenic
1054622794 9:67366258-67366280 TTAGAAATTTGGCCTTTGGGGGG - Intergenic
1054721110 9:68604910-68604932 TTGGGAATATGGGTTTTGGGAGG - Intergenic
1055842676 9:80524659-80524681 TTAGGATTATGGGTTTTGGGGGG + Intergenic
1056986323 9:91366598-91366620 TTAAGAATATGGGCTTTGGCTGG - Intergenic
1057931714 9:99199442-99199464 TTGGTGCTCTTGGCTTTGGGAGG + Intergenic
1061900652 9:133670486-133670508 TTGGTACCAGGGGCTTTGAGTGG + Intronic
1185431730 X:15105-15127 TTGGAGATATGGCCTTTGGGAGG - Intergenic
1185441051 X:227824-227846 TTGGAGATATGGCCTTTGGGAGG - Intergenic
1185456485 X:313297-313319 TTGGAAATATGGTCTTTGTAGGG + Intronic
1189136787 X:38558800-38558822 TTGTTAACATGGGCTTGGAGTGG + Intronic
1189158936 X:38790731-38790753 TTGATTATATAGGCTTTGGAGGG + Intergenic
1193769314 X:85570104-85570126 ATGGTAATATGGACTTTGAGAGG - Intergenic
1198010311 X:132545809-132545831 TTGGAAGTGTGGCCTTTGGGAGG + Intergenic
1198065497 X:133092580-133092602 TTGCTAATATTGGCTTTTGTGGG + Intronic
1198549352 X:137728270-137728292 TTGGGAATATGGGTCTTGTGTGG + Intergenic
1199688284 X:150284222-150284244 TTGGAGGTAAGGGCTTTGGGAGG - Intergenic
1200165540 X:154032737-154032759 TTAGGAATTTGGGCTGTGGGTGG + Intronic
1201278816 Y:12322838-12322860 GTGGTAATAAGGGCTTTGGGGGG - Intergenic