ID: 1090966247

View in Genome Browser
Species Human (GRCh38)
Location 11:131599882-131599904
Sequence CTAACTCTGCCCAGGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 270}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090966247_1090966259 18 Left 1090966247 11:131599882-131599904 CCTGCCTCCCTGGGCAGAGTTAG 0: 1
1: 0
2: 2
3: 20
4: 270
Right 1090966259 11:131599923-131599945 TTCTGGAGTAAGGACAGTTAAGG 0: 1
1: 0
2: 1
3: 14
4: 166
1090966247_1090966254 1 Left 1090966247 11:131599882-131599904 CCTGCCTCCCTGGGCAGAGTTAG 0: 1
1: 0
2: 2
3: 20
4: 270
Right 1090966254 11:131599906-131599928 CCCTGCGGGTGACTCCCTTCTGG 0: 1
1: 0
2: 0
3: 6
4: 105
1090966247_1090966256 8 Left 1090966247 11:131599882-131599904 CCTGCCTCCCTGGGCAGAGTTAG 0: 1
1: 0
2: 2
3: 20
4: 270
Right 1090966256 11:131599913-131599935 GGTGACTCCCTTCTGGAGTAAGG 0: 1
1: 1
2: 0
3: 10
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090966247 Original CRISPR CTAACTCTGCCCAGGGAGGC AGG (reversed) Intronic
900170984 1:1268658-1268680 ATAAGACTGGCCAGGGAGGCAGG + Intronic
900732415 1:4271086-4271108 CTAACACTGCCCATGGTGGGTGG + Intergenic
900876676 1:5347832-5347854 CTAATCCTCCCTAGGGAGGCTGG - Intergenic
901872267 1:12145059-12145081 AAAGCTGTGCCCAGGGAGGCAGG - Intergenic
902334654 1:15747880-15747902 CCACCCCTGCCCAGGAAGGCAGG - Exonic
902400559 1:16154844-16154866 CTCGCTCTGCCCAGGCAGGAGGG + Intronic
902552900 1:17229828-17229850 CTAACCCAGCACAGGGAGTCAGG - Intronic
902682271 1:18051746-18051768 CTAACTCAGCCTAGGGAATCAGG - Intergenic
902833703 1:19033889-19033911 CTAACTCAGCCCCTGCAGGCTGG - Intergenic
903535406 1:24063306-24063328 CTGCCTCTGCCCTGGGGGGCAGG + Intronic
903857846 1:26347123-26347145 CTAACTCTGTTCAGGGAAGATGG + Intronic
905811291 1:40915352-40915374 ATCACTCTGCCCAGGAAGGAGGG - Intergenic
907603545 1:55793914-55793936 GTAGCTCTGCCCAGGAGGGCGGG - Intergenic
909599044 1:77441972-77441994 GTGATTCTGCCCTGGGAGGCAGG + Intronic
909858148 1:80567085-80567107 TGTACTCTGCCCAGGGAAGCTGG + Intergenic
910672411 1:89786458-89786480 TGTACTCTGCCCAGGGTGGCTGG + Intronic
913074831 1:115333124-115333146 CTAAGTGAGCCCAGGGAGGATGG - Intronic
913257614 1:116968191-116968213 CTAACTCTGCCCTGGGTTCCTGG + Intronic
914901559 1:151713932-151713954 CCAGGTATGCCCAGGGAGGCAGG - Intronic
915525782 1:156475515-156475537 CTCACTCTGCACTGGGAGGCTGG - Intronic
915573618 1:156760391-156760413 CTACCTCTACCCTGAGAGGCAGG - Intronic
916166290 1:161969768-161969790 CCAACTCTGCCCATGGAGCCTGG - Intergenic
921075152 1:211694762-211694784 CTGCCTCTGCCCAGGGTGGAGGG - Intergenic
921338062 1:214107924-214107946 CTTCCTCTGCCCAGGAAGCCTGG - Intergenic
922875233 1:228935280-228935302 CAGAACCTGCCCAGGGAGGCAGG - Intergenic
922992087 1:229922991-229923013 TTAACTCTTCCCAGGGAGAATGG + Intergenic
923031423 1:230252028-230252050 ACATCTCTGCCCAGGAAGGCTGG + Intronic
924360212 1:243232434-243232456 CTAACTCTGCCCTGGGGGAATGG - Intronic
924384264 1:243487803-243487825 CTACCTGTGCCGGGGGAGGCGGG - Intronic
924546292 1:245030973-245030995 GTATCTGTGCCTAGGGAGGCAGG + Intronic
1067494633 10:46750790-46750812 CTCTCTCTGCCCAGGGAGAAAGG - Intergenic
1067600023 10:47589608-47589630 CTCTCTCTGCCCAGGGAGAAAGG + Intergenic
1068617173 10:59131726-59131748 CTAACTCTACCCAGGGACATGGG + Intergenic
1070334176 10:75439859-75439881 CTAAGTCTGCTCTGGGAAGCTGG - Intronic
1071502954 10:86216589-86216611 CTAATTCTGCCCAAGAAGGAGGG + Intronic
1072669751 10:97420654-97420676 CTATCTCTGCCCAGGAATTCCGG + Intronic
1072676094 10:97467273-97467295 TTAAATCTGCCCCAGGAGGCGGG - Intronic
1073099319 10:100998607-100998629 CTGCCTTTGCCCAGGGATGCAGG + Intronic
1074853132 10:117454605-117454627 CTCTCCCTGCTCAGGGAGGCAGG + Intergenic
1074892531 10:117747655-117747677 CTGAGTCTGCCAAGGGAGTCGGG - Intergenic
1075629458 10:123992229-123992251 GTAACTGGGCCCAGGGCGGCGGG + Intergenic
1075938893 10:126371166-126371188 CTCACCATGCCCTGGGAGGCAGG - Intronic
1076237760 10:128878941-128878963 CTAATTCTGCCCAGAGAGAATGG + Intergenic
1076243480 10:128928044-128928066 CAAACTCAGCCCAGGGAGCGCGG + Intergenic
1076252210 10:128993795-128993817 GCCACTCTGCCCAGGGTGGCGGG + Intergenic
1076622894 10:131804135-131804157 CTAACCCTGCACTGGAAGGCAGG - Intergenic
1076808049 10:132869154-132869176 CTCACTCTCCCCAGAGGGGCAGG + Intronic
1077225591 11:1437860-1437882 CCCACACTGCCCAGGAAGGCAGG - Intronic
1077230145 11:1455064-1455086 CTCACCCTGCCCTCGGAGGCCGG + Intronic
1077231325 11:1459333-1459355 CTACATCTACACAGGGAGGCCGG - Intronic
1077368058 11:2169229-2169251 CCCACTGTGCCCCGGGAGGCAGG - Intronic
1077463908 11:2724440-2724462 CTAACACTGCCCTTGGAGGAAGG + Intronic
1077548690 11:3189383-3189405 CAAACTCTGGCCAGGGAGGCGGG + Intergenic
1078451522 11:11444103-11444125 ACAACTCTCCCCAGGGAAGCCGG + Intronic
1078569033 11:12441730-12441752 CCAAATCTGCTGAGGGAGGCAGG + Intronic
1078717576 11:13854592-13854614 CACATTCTGCCCAGGGTGGCAGG - Intergenic
1079416598 11:20243527-20243549 CTCAGTGTGCCCAGGGAGCCTGG - Intergenic
1079758699 11:24300706-24300728 CTAACTCTGACCTGAGGGGCAGG + Intergenic
1081276011 11:41149626-41149648 CTATCTGTGCCCAGGAAGGCAGG - Intronic
1083214544 11:61210225-61210247 CCAGCTCTCCCCAGGGATGCTGG - Intronic
1083217428 11:61229054-61229076 CCAGCTCTCCCCAGGGATGCTGG - Intronic
1083220420 11:61248804-61248826 CCAGCTCTCCCCAGGGATGCTGG - Intronic
1083923209 11:65791454-65791476 CTTACTCTCCCCAGAGAGCCAGG + Intronic
1084658661 11:70534493-70534515 CTTGCTCAGCCCTGGGAGGCAGG + Intronic
1085041130 11:73327009-73327031 TTACCCCTGCCCAGGGAGCCTGG - Intronic
1085312345 11:75524163-75524185 ATACCTCTGCCCAGGAAGGAAGG - Intronic
1089495647 11:118907597-118907619 CCACCTCTGCCCAGGCAGGACGG + Exonic
1090546577 11:127773136-127773158 CTAGCTCTGCCTGGGGAGGATGG + Intergenic
1090966247 11:131599882-131599904 CTAACTCTGCCCAGGGAGGCAGG - Intronic
1091346402 11:134857133-134857155 CTAACTCTCTCCAGGGATCCAGG + Intergenic
1092297312 12:7210618-7210640 CTTACACTGCCCAAGGAAGCTGG - Intronic
1093211105 12:16309996-16310018 CTAGTTCTGCCCAGGCATGCTGG + Intergenic
1097730504 12:63123389-63123411 GTGACTTTGCCCAGGGAGGCAGG - Intergenic
1100006514 12:89901469-89901491 CTCTCCCTTCCCAGGGAGGCAGG + Intergenic
1101914437 12:108885243-108885265 CTAAGTCTGCAGAGGGAGTCAGG + Intronic
1102245221 12:111351685-111351707 CTCACTCTGCCCACCCAGGCTGG - Intergenic
1103100780 12:118173290-118173312 ATAAGTCTGGCCAGGTAGGCAGG + Intronic
1104228225 12:126857899-126857921 CTCACTCTGTCCGCGGAGGCTGG + Intergenic
1105461676 13:20595842-20595864 CTCATCTTGCCCAGGGAGGCTGG - Intronic
1106048024 13:26163581-26163603 CTAACTCTGTCCAGGGACCTGGG + Intronic
1110171628 13:72507609-72507631 TTAACTATGCACAGAGAGGCTGG - Intergenic
1110993114 13:82069292-82069314 CTATCTATGCCCAGGAAGGGTGG + Intergenic
1112027071 13:95420833-95420855 CTCAGTCTGCCCAGGCTGGCTGG - Intergenic
1113514923 13:110887014-110887036 GTATCTCTGAGCAGGGAGGCTGG - Intronic
1114147636 14:19995366-19995388 CTACCTCTTCACAGGGTGGCAGG + Intergenic
1114224207 14:20723476-20723498 CCACCTCTGCCCGCGGAGGCCGG - Intergenic
1114405260 14:22450423-22450445 CTGACTCTGCTCAGGGAGTTGGG - Intergenic
1117745850 14:58868734-58868756 TTAACTCTACCCAAGGATGCTGG - Intergenic
1117827776 14:59721308-59721330 CTGTCTGTGCCCTGGGAGGCAGG - Intronic
1118519546 14:66567013-66567035 CTAGCACTGCTCAGGTAGGCAGG + Intronic
1119442305 14:74636695-74636717 CACACTCTCTCCAGGGAGGCTGG - Intergenic
1121660458 14:95631518-95631540 CTGACTCTGACCATGGAGGAAGG + Intergenic
1122114050 14:99518841-99518863 CCACCACTGCCCAGTGAGGCGGG - Intronic
1122952983 14:105056158-105056180 CTCCCTCTGCCCAGGGAGGAAGG - Exonic
1123178857 14:106447918-106447940 GGACCTCTGCCCAGGGAAGCCGG - Intergenic
1123946624 15:25241970-25241992 CCAACCCTGCACAGGGAGCCTGG - Intergenic
1124087263 15:26562581-26562603 CAAACTCTGCCCTGGAGGGCTGG - Intronic
1127256768 15:57299588-57299610 CCAGATCTGCCCAGGGAGGCTGG + Intergenic
1128985361 15:72216690-72216712 CTAAATCTGGCAATGGAGGCAGG + Intronic
1129269020 15:74409800-74409822 CTGGCTCTGCCCTGGGAGCCCGG - Exonic
1129394913 15:75238437-75238459 CTAAGGCTGGGCAGGGAGGCAGG - Intergenic
1129782330 15:78280882-78280904 ATAACTCTGCCAAGGGAAGAGGG - Exonic
1130915299 15:88300054-88300076 GGAACTCTGAGCAGGGAGGCTGG - Intergenic
1132009018 15:98257919-98257941 CTGCCTCTGCTCAAGGAGGCTGG - Intergenic
1132292450 15:100713103-100713125 GAAACGCTGCCCAGGGAGGGAGG - Intergenic
1132514483 16:359862-359884 CTGAGGCTGCCCAGGGAGGTGGG - Intergenic
1132569626 16:638444-638466 CTCACACAGGCCAGGGAGGCAGG - Intronic
1132804488 16:1769270-1769292 CTCACTCTGCCTAGGGGAGCTGG + Exonic
1132973672 16:2701163-2701185 CTGAAGCTGCCCCGGGAGGCAGG - Intronic
1133033974 16:3024482-3024504 CAGACTCTGACCAGGGGGGCGGG + Intronic
1134123732 16:11602061-11602083 ATAACTCTGCCCAATGGGGCCGG + Intronic
1136129636 16:28211715-28211737 CCACCTCTGCCCGCGGAGGCCGG - Exonic
1136234564 16:28905741-28905763 CTCAGGCTGCACAGGGAGGCTGG + Exonic
1137291659 16:47055686-47055708 GTAACCCTGCCCAGGAGGGCGGG + Intergenic
1137539413 16:49351796-49351818 CTAAATCGGCCCAGTGAGGCTGG + Intergenic
1137945078 16:52726202-52726224 ATAATTCTGCCCAGGAAGGTGGG - Intergenic
1138419472 16:56889966-56889988 TCAACTCTGCCCATGGAGGTGGG - Intronic
1142151279 16:88513542-88513564 CACCCTCTGCCCAGGAAGGCCGG - Intronic
1142201010 16:88761175-88761197 CTGTCTCTGCCCAGGGAGCGGGG + Intronic
1143258742 17:5583289-5583311 CTCACACAGCCCAGGGAGGCGGG + Intronic
1144244061 17:13345852-13345874 TTAACTCAGCCCATGGTGGCAGG + Intergenic
1145758416 17:27409600-27409622 CTACCTCAGCCTAGGGAAGCAGG + Intergenic
1145829335 17:27902638-27902660 CTAATTCAGCCCAGGGAAGGTGG + Intergenic
1146575996 17:33992002-33992024 GTAACACTGCCCTGGGAGGCAGG + Intronic
1147359582 17:39922516-39922538 CTTCCCCTGCCCAGGGTGGCAGG - Exonic
1148157096 17:45430812-45430834 CCAACTCTGACCAGGGGGTCGGG - Intronic
1150882440 17:69045707-69045729 GTACCTCTTTCCAGGGAGGCAGG + Intronic
1151971377 17:77459166-77459188 CTCACTCTTCCCAGGCGGGCAGG - Intronic
1152735605 17:81995537-81995559 CTAACTCTGACCTGTGAGGAAGG - Intronic
1152763310 17:82121258-82121280 CTGTCTCAGCCTAGGGAGGCAGG + Intronic
1152922663 17:83073658-83073680 ATGACTCAGCCCAGGCAGGCGGG - Intergenic
1153496490 18:5704927-5704949 CTAACTCTCCAGAGGGTGGCTGG - Intergenic
1153725509 18:7950372-7950394 CTCACTCTGTCCAGGTTGGCTGG - Intronic
1154173368 18:12066980-12067002 CTCACCCTGAGCAGGGAGGCTGG + Intergenic
1155008740 18:21754032-21754054 CCATCTCTGCCCTGTGAGGCTGG + Intronic
1160592154 18:79951048-79951070 CGAGTTCCGCCCAGGGAGGCTGG + Intronic
1162301502 19:9847580-9847602 CCACCTCTGCCCAGGGGGCCCGG + Intronic
1162402370 19:10453958-10453980 CAGACTCTGTCCAGGGAAGCAGG - Intronic
1163199910 19:15759815-15759837 CTGACTCTGCCCAGGCAGCCTGG - Intergenic
1166137524 19:40786415-40786437 CTGACTCAGCCCAGGAAGTCAGG + Intronic
1166473072 19:43096920-43096942 CTAAGTAGGCCCAGGAAGGCAGG - Intronic
1166912991 19:46174096-46174118 CTTTCTCAGCCCAGGCAGGCAGG - Intergenic
1167555800 19:50194614-50194636 CTAAGTCAGCCCTGTGAGGCAGG - Intronic
1167659652 19:50789158-50789180 CTGACTGTGCGCAGTGAGGCAGG + Intergenic
1167710543 19:51107947-51107969 CCGACTCTGCGCAGGGCGGCGGG - Intronic
1168267722 19:55231551-55231573 CTCTCTCTGCCCAGGGCCGCGGG + Intronic
927143078 2:20142809-20142831 GTAACAGTGCCCAGGGAAGCAGG - Intergenic
927430335 2:23021907-23021929 CTAAGTCTGCACAGAGAGGGTGG + Intergenic
927999356 2:27509134-27509156 CTGATTCTGCCCATGGAGGGTGG - Intronic
931859910 2:66344253-66344275 CTAATTCTGCCCAGCAGGGCTGG - Intergenic
933841894 2:86293735-86293757 CAAACACTGCCAAGTGAGGCTGG + Intronic
934853978 2:97717829-97717851 CTGCCTTTACCCAGGGAGGCTGG + Intronic
937260034 2:120579473-120579495 CTAAGTCTGCACAGGGAGCTGGG - Intergenic
937908051 2:127061956-127061978 CTCTCTGTGCTCAGGGAGGCAGG - Intronic
938152678 2:128900833-128900855 CTGACTCTCCCCAGGGGGCCAGG - Intergenic
938262905 2:129907777-129907799 CCATCTCTGTCCGGGGAGGCGGG - Intergenic
939247546 2:139645233-139645255 CAAACTCTGCACAGGAAGGGTGG + Intergenic
940149069 2:150578912-150578934 CTGAGGCTGCACAGGGAGGCAGG + Intergenic
941834101 2:169997248-169997270 CTCACTCTACCCAGGCTGGCTGG + Intronic
946415847 2:219539287-219539309 CCAGCCCTGCCCAGCGAGGCTGG + Exonic
946949766 2:224860866-224860888 CTAACTCTGGCCAGGCATGGTGG - Intronic
947513969 2:230785067-230785089 CTAATTCTGTCCAGGCATGCTGG + Intronic
948716025 2:239864441-239864463 CTCACTCTGCTCCCGGAGGCTGG + Intergenic
948739262 2:240032261-240032283 CGGACGCTGCCGAGGGAGGCTGG + Intergenic
948800869 2:240433002-240433024 CTGCCTCTGCCTAGGGAGGGTGG - Intergenic
1168808799 20:689254-689276 CAAACCCTGCCCAGGCAGCCCGG + Intergenic
1170337850 20:15290749-15290771 CTTCCTTTGCCCAGAGAGGCTGG - Intronic
1170906367 20:20518349-20518371 CTATCTCTGGTCAGGGTGGCCGG - Intronic
1172568712 20:35952677-35952699 CTATCTTTTTCCAGGGAGGCAGG + Intergenic
1173241677 20:41302468-41302490 CGAACTCTGCCCATAGAGGCAGG + Intronic
1174455383 20:50645254-50645276 CTACCCCTGCCCAGGAAGGCAGG + Intronic
1174536190 20:51253405-51253427 CTAACACTGCCCTGGGATGAAGG - Intergenic
1175241044 20:57549135-57549157 CTAACTCTCCCCGGGAAGCCAGG - Intergenic
1175405220 20:58721758-58721780 CCACCTGTGCCCCGGGAGGCAGG + Intergenic
1175687255 20:61040670-61040692 CTGTCTCTGCCTGGGGAGGCCGG - Intergenic
1176388869 21:6153549-6153571 CCACCTGTGCCCAGGTAGGCAGG - Intergenic
1176717655 21:10367084-10367106 CTCAGGCTGCCCAGGGATGCTGG - Intergenic
1179312992 21:40213358-40213380 CTATGTGTGCACAGGGAGGCAGG - Intronic
1179734603 21:43384699-43384721 CCACCTGTGCCCAGGTAGGCAGG + Intergenic
1179784508 21:43721839-43721861 TTTGCTCTGCCCAGGGAGGGTGG - Intronic
1180057921 21:45368572-45368594 CTTATTCTGCACAGGGAGGACGG + Intergenic
1180253352 21:46605111-46605133 TTCCCTCTGCCCAGGGAGGATGG + Exonic
1180298882 22:11020004-11020026 CTCAGGCTGCCCAGGGATGCTGG - Intergenic
1181484909 22:23224535-23224557 CCAAGTCTGCCCAGAGACGCTGG + Intronic
1181763914 22:25077529-25077551 CCACCTCTGCCATGGGAGGCTGG - Intronic
1183391380 22:37547180-37547202 CTCACCCTGCTCAGGCAGGCCGG - Intergenic
1184020793 22:41820023-41820045 CTCACTCTGTCCACGCAGGCTGG + Intronic
1184108855 22:42383750-42383772 CCAAATGTGCCCAGGGAGGGGGG - Exonic
1184520691 22:44992272-44992294 CTGCCGCTGCCCAGGGATGCTGG + Intronic
1185313447 22:50169248-50169270 CCTACGCAGCCCAGGGAGGCAGG + Intergenic
949925878 3:9041248-9041270 CTAAGTTTACCCAGGGAAGCTGG + Intronic
950208261 3:11096662-11096684 CCTGCTCTGCCCAGGGAGGTCGG - Intergenic
951916102 3:27802494-27802516 TTAACTCTGCCCATGGAGTTAGG + Intergenic
952918080 3:38264681-38264703 CTGACATTGCTCAGGGAGGCTGG + Intergenic
955237031 3:57148787-57148809 CACACTCTGTCTAGGGAGGCAGG + Intronic
955391281 3:58524262-58524284 CTCTCTCTGCCCATGGTGGCAGG + Intronic
959094860 3:101943805-101943827 CCAACTCTGCCAAGGTAGGTTGG - Intergenic
960046524 3:113204042-113204064 CAACCACTGTCCAGGGAGGCCGG + Intergenic
961203453 3:125062446-125062468 CCAGCTCTGCCCAAGGATGCCGG - Intergenic
961525262 3:127492737-127492759 TCAACTGTGGCCAGGGAGGCAGG - Intergenic
962576017 3:136755843-136755865 AAAACTCTGTCCAGGGAGGGTGG - Intergenic
962865584 3:139445765-139445787 CTGCCACTGCCCAGGGAGCCTGG - Intergenic
963263504 3:143216256-143216278 TCAACTCTGGCCAGAGAGGCAGG - Intergenic
965990383 3:174810902-174810924 CTAAGGCTGCACAGGGTGGCAGG - Intronic
968068888 3:195773846-195773868 CCAACTCTGCTCCAGGAGGCAGG + Intronic
968673107 4:1862819-1862841 CTCCCTCTCCCCAGGGCGGCAGG - Intergenic
968742058 4:2336042-2336064 CCACCTCTGCCCCAGGAGGCAGG + Intronic
969084613 4:4646549-4646571 CTAACTCGGGCCTGGGAGGCAGG + Intergenic
969235064 4:5859788-5859810 CAAACTCTGCCCATGGCGGTGGG + Intronic
970044026 4:11829716-11829738 CTAACTCTGAAAAGGGAGGAAGG - Intergenic
970555804 4:17231354-17231376 CTCACTCCCCCCAGGGAGGGAGG + Intergenic
978365073 4:107972946-107972968 CTAAGTCTTCCCAGGGAAGGGGG - Intergenic
979946940 4:126843878-126843900 CTAACTCTGCCCACTCAGCCTGG - Intergenic
980908296 4:138970860-138970882 TTATCTCTGCCCAGGGAGACAGG - Intergenic
984131400 4:175879463-175879485 CTAACTCTTCACAGGGCGGCAGG + Intronic
984638680 4:182141197-182141219 CAAACTCTGCCCGGCGCGGCTGG - Intergenic
985467892 5:14831-14853 CTAGTTCTGCCCAGGCATGCTGG - Intergenic
985766129 5:1780419-1780441 CCACCACTGCCCAGGGAGGGTGG + Intergenic
986703753 5:10438069-10438091 CTTACTCTTCCCAGTGAGGACGG - Exonic
988104761 5:26730330-26730352 CTAACACTTCCCAGTGAAGCTGG - Intergenic
988309963 5:29543976-29543998 CAAACACTGCCCAGGGATACTGG - Intergenic
989213983 5:38884824-38884846 CTGACTTTGGCAAGGGAGGCAGG - Intronic
989432685 5:41374065-41374087 CTAACTGAGCCTAGGGAGGAGGG + Intronic
989532003 5:42518595-42518617 CTAACTCTGAACAGAGAGGTTGG - Intronic
991198273 5:63960785-63960807 TTGCCTCTGCCCAGCGAGGCTGG - Exonic
997695241 5:135856376-135856398 ACCCCTCTGCCCAGGGAGGCTGG + Intronic
998515839 5:142753330-142753352 CTAAACCTGTCCTGGGAGGCAGG + Intergenic
999253918 5:150199065-150199087 CCAACTCTGACCCAGGAGGCTGG - Intronic
1000294121 5:159898047-159898069 CTCACCCTGCCCAGCCAGGCAGG + Intergenic
1001080694 5:168665203-168665225 CTTATCCTTCCCAGGGAGGCAGG + Intronic
1002017729 5:176338999-176339021 CTACCTCTGCCCAGGGACGCAGG - Intronic
1002204413 5:177553342-177553364 CTGAGCCTGCCCAGGAAGGCAGG - Intronic
1002268923 5:178056688-178056710 GGAACTCTGCCCTGGGAAGCCGG - Intergenic
1006414167 6:33893462-33893484 GCCACTCAGCCCAGGGAGGCAGG + Intergenic
1006571810 6:35011749-35011771 CTAACACTGCACAGAGAGGCTGG - Intronic
1007722376 6:43892658-43892680 CTCACCCTGCCCAGTGAGGAAGG + Intergenic
1007748742 6:44059012-44059034 CCAGCCCTCCCCAGGGAGGCGGG - Intergenic
1007760232 6:44128733-44128755 CTCACCCTGGCCTGGGAGGCAGG - Intronic
1010405233 6:75497311-75497333 CCAACTCTGTCCAGAGAGCCTGG - Intergenic
1010649802 6:78439940-78439962 CTAAATCTGCCTAGAGAAGCTGG - Intergenic
1012445681 6:99304892-99304914 CCAACATAGCCCAGGGAGGCTGG + Intronic
1012475956 6:99614587-99614609 CAGACTCTGGCCAGGGTGGCGGG - Exonic
1015424945 6:133054821-133054843 CTAACTCTGCCCTGGCAGAAAGG + Intergenic
1015603534 6:134933488-134933510 CTATCTTGGCCCAGGGAAGCAGG + Intronic
1016391262 6:143578344-143578366 TTAACTTTCCTCAGGGAGGCAGG + Intronic
1017866601 6:158449290-158449312 ATAACTCTTCCCAGGAAGCCCGG - Intronic
1020112011 7:5452546-5452568 CCCGCTCTGCCCAGAGAGGCCGG + Intronic
1023788995 7:43737288-43737310 GTAGCTCTGCCCAGGAGGGCAGG - Intergenic
1024761406 7:52601071-52601093 GTACCTCTTCCCAGGGTGGCAGG - Intergenic
1025074919 7:55934587-55934609 TCACCTCAGCCCAGGGAGGCTGG - Intronic
1028487955 7:91380549-91380571 CAAAATCTGTCCATGGAGGCTGG + Intergenic
1030065478 7:105655840-105655862 CTCCCTCTCCCCAGGTAGGCGGG - Intronic
1032982539 7:137300526-137300548 CTAACTCTTCCTTGGGAGGCAGG + Intronic
1033686278 7:143644061-143644083 CCAGCTCTCCCCAGGGAGCCAGG + Intronic
1033689460 7:143723254-143723276 CCAGCTCTCCCCAGGGAGCCAGG - Exonic
1033698335 7:143813560-143813582 CCAGCTCTCCCCAGGGAGCCAGG - Intergenic
1034400102 7:150856540-150856562 GGGACTCTGCCCAGGAAGGCAGG + Exonic
1035513835 8:214662-214684 CTAGTTCTGCCCAGGCATGCTGG - Intergenic
1041271267 8:56111526-56111548 CTAACTCTGTCCAGGTAGTTGGG - Intergenic
1043680438 8:83018512-83018534 CAAACACTGCCCAGGCAGGGCGG - Intergenic
1046170506 8:110498849-110498871 CCATCTCTTCACAGGGAGGCAGG - Intergenic
1048945719 8:139445311-139445333 ATAACCCTTCCCAGGGAGTCTGG + Intergenic
1048966125 8:139615968-139615990 CTAACTCAGCCCTCGGAGGAGGG - Intronic
1048995318 8:139790475-139790497 CCATCTCTGCCCTGAGAGGCAGG + Intronic
1049579780 8:143406074-143406096 CTATCACAGCCCAGGGGGGCAGG + Intergenic
1049595160 8:143480067-143480089 CTACCTGTGCCTAGCGAGGCTGG - Intronic
1056921726 9:90796538-90796560 CTTACTCTGTCCAGCGAGGTTGG - Intergenic
1057866649 9:98686934-98686956 CTGACTCTGCTGAGGGAGGGTGG - Intronic
1058825687 9:108774301-108774323 CTAATTCTCCCCATGGATGCTGG - Intergenic
1059418050 9:114174223-114174245 TTAACTCTCCCCAGTGAGTCTGG - Intronic
1059431307 9:114252097-114252119 CCAACTCTGCCCAGTGTGTCTGG + Intronic
1059845416 9:118270076-118270098 CCAACACTGACCAGGGAGCCAGG - Intergenic
1060722130 9:125986410-125986432 CTCACTCTGGTCAGGGAAGCTGG + Intergenic
1060807765 9:126588266-126588288 CAGGCTCTGCACAGGGAGGCTGG - Intergenic
1060950707 9:127600460-127600482 CTCACTCTGCCCACTGAGGCGGG - Intergenic
1061036371 9:128116507-128116529 CTCACTCTCCTCAGGGAGGACGG + Intergenic
1062049844 9:134441722-134441744 CTGACTCCACCAAGGGAGGCTGG - Intergenic
1062450468 9:136613764-136613786 CTGACCCTGCTCAGGGAGTCTGG - Intergenic
1062627056 9:137448111-137448133 CCAACTCTGTCCAGGCAGGAAGG + Exonic
1203791700 EBV:155069-155091 CTAATTTTGCCCAGAGAGGCTGG + Intergenic
1185592794 X:1288745-1288767 CTACCTCTTCCCAGGAAGGGAGG + Exonic
1188758499 X:33995298-33995320 CCACCTCTTCACAGGGAGGCAGG - Intergenic
1189825622 X:44913807-44913829 CTAGTTCTGCCCAGGCATGCTGG - Intronic
1191115667 X:56849723-56849745 CTAGCTCTGCCCAGAGATTCTGG - Intergenic
1192438009 X:71154577-71154599 TTAAGTCTGCCCAGGGAGAATGG + Intronic
1193974866 X:88105109-88105131 CGAACTCTGCCAGGGGAGGGGGG - Intergenic
1194766960 X:97852729-97852751 CTAACTCTGTCCAGAAAGACAGG - Intergenic
1195540504 X:106057307-106057329 CTATCTCTTCACAGGGTGGCAGG - Intergenic
1195675459 X:107504152-107504174 CTGAGACTGCCAAGGGAGGCTGG + Intergenic
1195721903 X:107876003-107876025 CAGACTGTCCCCAGGGAGGCTGG - Intronic
1197415485 X:126167041-126167063 CGAACTCAGCCCAGGGCGGGTGG + Intergenic
1199692477 X:150319290-150319312 CCAACTAGGCCCAGGGAGGCTGG - Intergenic
1200066538 X:153506755-153506777 CTAGCTCTGCCCCAGGTGGCGGG - Intronic