ID: 1090966422

View in Genome Browser
Species Human (GRCh38)
Location 11:131601209-131601231
Sequence GGGAGCATACAGATGGACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 2, 2: 4, 3: 17, 4: 204}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090966413_1090966422 27 Left 1090966413 11:131601159-131601181 CCTCAACCTCTGATTTGGCTTGG 0: 1
1: 0
2: 2
3: 20
4: 223
Right 1090966422 11:131601209-131601231 GGGAGCATACAGATGGACAGTGG 0: 1
1: 2
2: 4
3: 17
4: 204
1090966415_1090966422 21 Left 1090966415 11:131601165-131601187 CCTCTGATTTGGCTTGGACAGCT 0: 1
1: 0
2: 0
3: 12
4: 100
Right 1090966422 11:131601209-131601231 GGGAGCATACAGATGGACAGTGG 0: 1
1: 2
2: 4
3: 17
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090966422 Original CRISPR GGGAGCATACAGATGGACAG TGG Intronic
900177724 1:1298222-1298244 GGGAGCAGAGAGCTGGACACGGG - Intronic
901225735 1:7611966-7611988 GGGTGCACAGAGATGGGCAGGGG + Intronic
901490804 1:9595392-9595414 GGGAGCCTCCAGATTGAAAGGGG - Intronic
903282356 1:22257276-22257298 GGGAGGACACAGAGGCACAGGGG + Intergenic
903506389 1:23838573-23838595 GGGGGCATACAGACAGGCAGAGG - Intronic
903872536 1:26446837-26446859 GAGGTCATACAGATGTACAGGGG + Intronic
904118233 1:28177787-28177809 GGGAGCATGCAGGTGAAGAGGGG + Intronic
905483625 1:38279803-38279825 GGAAGCAGACAGTTAGACAGAGG - Intergenic
905803185 1:40858935-40858957 GACAGCAGACAGATGGACAGGGG - Intergenic
907415409 1:54310881-54310903 GGGAGCATGCAGATTGGCAGTGG + Intronic
908927761 1:69277034-69277056 AGGGTCATACAGATGGTCAGTGG - Intergenic
908930409 1:69311515-69311537 CGGAGCACAGAGCTGGACAGAGG - Intergenic
911260992 1:95685221-95685243 GGGAGGTGACAGAAGGACAGAGG - Intergenic
911516416 1:98873482-98873504 GGGTCCATACAGATGTTCAGAGG - Intergenic
912274480 1:108242035-108242057 GGGGGCAGGCAGATGGGCAGGGG - Intronic
912286787 1:108377823-108377845 GGGGGCAGGCAGATGGGCAGGGG + Intronic
912293739 1:108452306-108452328 GGGGGCAGGCAGATGGGCAGGGG + Intronic
912681928 1:111734240-111734262 AGGGGCAGACAGATGGAGAGGGG + Intronic
914783408 1:150806497-150806519 GGAAGGATACAGTTTGACAGAGG + Intronic
915462552 1:156078904-156078926 GGGAGGATGGGGATGGACAGTGG - Intronic
915873222 1:159584482-159584504 GAGAGCATTTAGATGGAAAGAGG - Intergenic
916894895 1:169151817-169151839 GGGAGGAGGCAGATGGACAGAGG - Intronic
918424373 1:184393230-184393252 GGGAGGAGCCAGATAGACAGTGG - Intronic
920856158 1:209663926-209663948 AGGAGGGCACAGATGGACAGAGG + Intergenic
922454906 1:225766897-225766919 GGGAGCCTAAAGATGGACCTCGG - Intergenic
922772812 1:228197169-228197191 GGGACCTTACTGAGGGACAGGGG - Intergenic
923400174 1:233609049-233609071 GTTAGCATTCGGATGGACAGAGG - Intergenic
923786647 1:237074445-237074467 GGGAGGACACTGATGGATAGAGG + Intronic
1063334681 10:5200019-5200041 GGGAGCATACAGATGGGGGCAGG - Intronic
1064099383 10:12450579-12450601 GGCAGCTCACACATGGACAGTGG + Intronic
1070170393 10:73928476-73928498 GGGAGCAGACAGAAGGGCAATGG + Intergenic
1070796657 10:79220672-79220694 GGGAAGCTAGAGATGGACAGGGG - Intronic
1072808995 10:98445314-98445336 TGGAGCATCCAGACGGCCAGAGG + Exonic
1073553196 10:104422601-104422623 GGGATCATTCACATGTACAGTGG + Intronic
1074781711 10:116807057-116807079 TGGAGCATCCAGAGGGACTGTGG + Intergenic
1075213676 10:120513177-120513199 GGGAACATACAACTGGAGAGGGG - Intronic
1076623125 10:131805817-131805839 GGGAACGTACAGATGGGCACAGG + Intergenic
1077471480 11:2762899-2762921 GTGGGCAGACAGATGAACAGTGG - Intronic
1077629898 11:3804282-3804304 GGAAGCAAGCAGATGAACAGGGG + Intronic
1077986232 11:7354100-7354122 GTGAACATAAAGATGGACACAGG - Intronic
1078590077 11:12632941-12632963 GGGAGCAGCCAGAAAGACAGAGG - Intergenic
1082085966 11:48049794-48049816 GTGGGCAGACAGATTGACAGTGG + Intronic
1082204749 11:49419389-49419411 GGAAGCATATAGAGGGGCAGAGG + Intergenic
1083016342 11:59457902-59457924 GTGAGCAGTCAGATGGAGAGTGG + Exonic
1083210203 11:61179481-61179503 AGGAGGATACAAATGGACAACGG - Intergenic
1084625413 11:70302425-70302447 GGGAGGATGGAGATGGGCAGTGG + Intronic
1084668707 11:70592586-70592608 GGGTGCAGACAGAGGGACAGAGG - Intronic
1085047357 11:73361431-73361453 GGCTGCATACATATGTACAGAGG + Intronic
1085523838 11:77153220-77153242 GGCGGCATGCAGATGGAGAGTGG + Intronic
1087397675 11:97622287-97622309 CAGAGCTGACAGATGGACAGAGG - Intergenic
1087608648 11:100407516-100407538 GGGAACACAAAGATAGACAGTGG - Intergenic
1087685641 11:101260766-101260788 GAGAGCATTAAGATAGACAGAGG + Intergenic
1090966422 11:131601209-131601231 GGGAGCATACAGATGGACAGTGG + Intronic
1090988876 11:131798245-131798267 AGGAGCAGACAGATGCCCAGGGG - Intronic
1092770184 12:11889694-11889716 GGGTTCATACTGATGAACAGTGG + Intronic
1092770586 12:11892839-11892861 GGGTGCAAACAGATGGACTATGG + Exonic
1093848731 12:24009693-24009715 GGAAGCTTACAGATGGCCTGTGG + Intergenic
1094018705 12:25891478-25891500 GTGAGCACACAGGTGGACAAAGG - Intergenic
1101751186 12:107583629-107583651 GGGGGCGCAGAGATGGACAGTGG - Intronic
1101803278 12:108041468-108041490 CTGAACATACAAATGGACAGTGG + Intergenic
1101984310 12:109433701-109433723 AGGAGTCTACAGATGGAGAGAGG - Intronic
1102996451 12:117355131-117355153 GGGAGCCTACAGATTTTCAGAGG - Intronic
1104571266 12:129927934-129927956 GGGAGCTTTCAGATGAAAAGAGG + Intergenic
1107645313 13:42488529-42488551 GAGAGCAGACAGGTGGCCAGTGG + Intergenic
1107993711 13:45840622-45840644 GGCAGCATAGAGAAGCACAGAGG + Intronic
1108690567 13:52855891-52855913 AGAAGAATGCAGATGGACAGTGG + Intergenic
1109300776 13:60587643-60587665 GGGAGCATGCAGACAGTCAGGGG - Intergenic
1109589806 13:64463182-64463204 GGGAGCAGACAGATGGACAGGGG - Intergenic
1112558754 13:100493173-100493195 GAGAGCACGCAGATGGGCAGGGG - Intronic
1112718625 13:102216052-102216074 GGGTGCATACAGTTAGGCAGTGG + Intronic
1112846682 13:103651996-103652018 TGGAGCCTACAGTAGGACAGAGG - Intergenic
1113572974 13:111371827-111371849 GGGAGGAGACAGAAGCACAGAGG + Intergenic
1113643304 13:111973689-111973711 AGGAGGAGAGAGATGGACAGAGG - Intergenic
1114691042 14:24581837-24581859 GAGAACATTCAGATGGAGAGGGG + Intergenic
1114735168 14:25036414-25036436 GGTAGCTTTCAGATAGACAGTGG - Intronic
1116623209 14:47232642-47232664 GGGAGCATACTTTTGGAGAGTGG - Intronic
1117575357 14:57092067-57092089 AGGGGCATTCAAATGGACAGTGG + Intergenic
1118693689 14:68363819-68363841 GGGAGCACACAGAAGCACAGTGG - Intronic
1120476176 14:84990392-84990414 GGGAGGATACAGGTGGGAAGTGG + Intergenic
1128785685 15:70395236-70395258 GGGAACAGACAGAAGGACACAGG + Intergenic
1129034520 15:72641355-72641377 GGGAGGAGGCAGAGGGACAGAGG + Intergenic
1129139558 15:73584924-73584946 GGAACCAGACAGAGGGACAGTGG - Intronic
1129215362 15:74095861-74095883 GGGAGGAGGCAGAGGGACAGAGG - Intergenic
1129392264 15:75226346-75226368 GGGAGGAGGCAGATGGACAGAGG + Intergenic
1129472130 15:75761819-75761841 GGGAGGAGGCAGATGGACAGAGG - Intergenic
1129846612 15:78770694-78770716 GGGAGGAGACAGAGGGCCAGAGG + Intronic
1131898884 15:97066073-97066095 AGGAGCATAAAGTTGGACACAGG - Intergenic
1132841995 16:1982590-1982612 AGGAGCATACAGATGGAGGGTGG - Exonic
1137975065 16:53024260-53024282 GGGAGGATGGAGAAGGACAGGGG + Intergenic
1140793841 16:78416873-78416895 GGGAGGACACAGATTCACAGGGG + Intronic
1141127430 16:81410791-81410813 GAGAGCATGCAGATGGTGAGTGG + Intergenic
1144314751 17:14049042-14049064 GGGGCCTTACAGAAGGACAGAGG + Intergenic
1144848611 17:18232879-18232901 GGCAGCATGGAGATGGGCAGCGG + Intronic
1144960495 17:19041714-19041736 GGCCCCAGACAGATGGACAGAGG + Intronic
1144974665 17:19132810-19132832 GGCCCCAGACAGATGGACAGAGG - Intronic
1146125853 17:30230773-30230795 GGGTGCATCCAGGTGGAGAGGGG + Intronic
1149052145 17:52318469-52318491 GTGAGCATACATATAGGCAGGGG - Intergenic
1149503772 17:57175684-57175706 GGGAGCAGACATGTGCACAGAGG + Intergenic
1150002863 17:61452301-61452323 GGGCGCAGACTGATTGACAGCGG + Intergenic
1150123399 17:62621391-62621413 GGGAGCTCAGAGAGGGACAGAGG - Intergenic
1150907510 17:69353841-69353863 GGGAGCAGGCAGATGGGGAGAGG + Intergenic
1150931479 17:69589977-69589999 GGGAGCACACAGACAGATAGGGG + Intergenic
1153332519 18:3888481-3888503 AGGAGCAGACTGATTGACAGAGG - Intronic
1153634744 18:7103936-7103958 GAGACCAGACAGACGGACAGAGG - Intronic
1154411154 18:14142965-14142987 GGCAGCTTACAGATGGGCAGAGG - Intergenic
1157187337 18:45551866-45551888 GGTGGCATTCAGATGGACAAAGG - Intronic
1157203801 18:45681642-45681664 GTGAGCAGAGAGATGGAGAGAGG - Intronic
1157445245 18:47740200-47740222 GGGAGTGTAGAGATGAACAGAGG + Intergenic
1157993489 18:52526282-52526304 GGGAGGAGACAGATGGCCAATGG + Intronic
1159553266 18:69918825-69918847 TGGAAAATACAGATGGAAAGTGG + Intronic
1160399905 18:78602584-78602606 GGGAGCACAAAGATGCACGGTGG - Intergenic
1161930441 19:7336239-7336261 GGGAGCAGAGAGATAGAGAGAGG + Intergenic
1162887449 19:13706312-13706334 GGGAGGAAAGAGAAGGACAGAGG - Intergenic
1163151755 19:15419089-15419111 GGAGGCATAGAGATAGACAGCGG - Intronic
1163683271 19:18695994-18696016 GGGAGCATGCAGGTGCAGAGGGG + Intronic
1166206429 19:41272666-41272688 AGCAACATACAGATGGACAGTGG + Intronic
1166893815 19:46010587-46010609 GGGAGAAGTCAGATGGGCAGGGG + Intronic
1167556100 19:50196650-50196672 ATAAACATACAGATGGACAGAGG - Intronic
1167687912 19:50968159-50968181 GGGAGCAGACAGAGGGATGGGGG - Intronic
1168500408 19:56888247-56888269 GGGAGTATAGAGAAGGAAAGGGG - Intergenic
925049137 2:797604-797626 AGGAGCATGCAGAGGGGCAGGGG + Intergenic
928389076 2:30895273-30895295 GGGAACCGACACATGGACAGAGG + Intergenic
928404389 2:31003583-31003605 GGGAGGAGAGAGATGGGCAGTGG - Intronic
930571646 2:53093372-53093394 GGGTCCATTCAGATGGTCAGGGG + Intergenic
930849640 2:55945545-55945567 GGGAGTATAAAAATAGACAGTGG - Intergenic
934987749 2:98899970-98899992 GAGGGGACACAGATGGACAGAGG + Intronic
936242423 2:110799437-110799459 GAGAGCAGACAGGTGGCCAGGGG - Intronic
940220830 2:151349588-151349610 GGTAGCATAGAGATGGAAAGAGG + Intergenic
941451162 2:165661959-165661981 GGAAAGATACAGAGGGACAGTGG - Intronic
943633850 2:190283443-190283465 GTGAGCATACACCTGGACAAGGG - Intronic
944742836 2:202629103-202629125 GGGAGCCTAGAGAGGAACAGAGG + Intergenic
945223962 2:207512817-207512839 TGGAGCAAACAGAAGGAGAGTGG + Intergenic
948118221 2:235509678-235509700 GGGTGCAAGCAGACGGACAGAGG - Intronic
948233049 2:236365778-236365800 GGGAGGACAAAGGTGGACAGAGG + Intronic
1170893466 20:20395021-20395043 GGGAGGATAAAGAGGGAAAGAGG + Intronic
1173530963 20:43769268-43769290 AGGTGCACACAGATGGCCAGAGG - Intergenic
1176030342 20:63008485-63008507 GGGAGCATTCAGGTGGCCGGAGG + Intergenic
1176861901 21:14015450-14015472 GGCAGCTTGCAGATGGTCAGAGG + Intergenic
1178114575 21:29404374-29404396 GGGAGCACACAGAGGGGCAGAGG + Intronic
1179623784 21:42635917-42635939 GGGAACAAATAGATGGACAATGG - Intergenic
1182517608 22:30867906-30867928 GGGGCCATTCTGATGGACAGGGG + Intronic
1183936921 22:41267896-41267918 GGGAGCACAGAGACTGACAGGGG - Intronic
1184447226 22:44555902-44555924 GGGAAGGTACAGATGGGCAGAGG + Intergenic
951716110 3:25648316-25648338 GGGAGCAGACAGATGGACAGAGG + Intronic
953319959 3:41962630-41962652 GGAAGGAAACAGAAGGACAGTGG - Intergenic
953454056 3:43028381-43028403 GGGTCCATTCAGATGGTCAGGGG + Intronic
953874014 3:46654383-46654405 AGGAGAATACAGATGGCAAGGGG + Intergenic
954195451 3:48994180-48994202 GGTAGCAGACCAATGGACAGAGG - Intronic
961664130 3:128485921-128485943 GAGAGCATGAAGATGGAAAGTGG - Exonic
963279431 3:143367669-143367691 GGGAGGGTCCAGATGGGCAGCGG + Intronic
965297612 3:166969571-166969593 TGGAGTTTAAAGATGGACAGAGG + Intergenic
965906411 3:173712503-173712525 GGGAGCACACAGGTAGTCAGTGG - Intronic
966213317 3:177475479-177475501 GGGAGCAGGCAGAGGAACAGAGG + Intergenic
966216875 3:177512991-177513013 GGGAGCAAAGAGAAAGACAGAGG + Intergenic
969096603 4:4737088-4737110 TGGAGCATGCACATGGGCAGAGG + Intergenic
970173109 4:13308700-13308722 TGCAGCACACAGAAGGACAGTGG + Intergenic
970449800 4:16155663-16155685 GGGAGCTTACAGATGCTCGGTGG + Intergenic
970995263 4:22260224-22260246 TGGACCAGACAGATGCACAGCGG + Intergenic
978398901 4:108310755-108310777 GGGAGCATGCAGGTGAGCAGGGG - Intergenic
979819112 4:125149005-125149027 AGGAGCAGACAGATTCACAGAGG - Intergenic
981450710 4:144894634-144894656 GAGACTATACAGATGGATAGTGG + Intergenic
982212816 4:153054185-153054207 TGTAGCATAGAGATGGAGAGAGG - Intergenic
982315153 4:154024253-154024275 GGGAGCATACAGATCGGCAGTGG - Intergenic
984121824 4:175754942-175754964 GGGAGTAGACAGAGGGAGAGAGG - Intronic
986405279 5:7419315-7419337 GGGAGAATACAGATGCACTTTGG + Intronic
988604913 5:32670635-32670657 GGGAGCATAAATTTGGAAAGTGG + Intergenic
988852965 5:35197376-35197398 GGGAGCAGCCAGAAGGAAAGGGG - Intronic
990699334 5:58459396-58459418 GGGAGCAGATAGAGGGAGAGAGG + Intronic
992770240 5:80040873-80040895 GGGAGCAGACACATGGGAAGAGG + Intronic
993773588 5:91962794-91962816 GGGAGCATGCAGATGGGCAGGGG - Intergenic
994828436 5:104746361-104746383 GGGAAAATACAGATGGTAAGTGG - Intergenic
1003115484 6:3281090-3281112 TGGAGCATCCAGATGGACAGTGG + Intronic
1003593198 6:7453028-7453050 GGAAGCATGCAGATGGGCAGGGG - Intergenic
1006337103 6:33426572-33426594 GGGAAGAGACAGATGGAGAGAGG - Intronic
1007499003 6:42281091-42281113 GGGAGCATGAAGATTGCCAGAGG - Intronic
1007686604 6:43670794-43670816 TGGAGCATCCAGATGGAGAGGGG + Exonic
1008197316 6:48539962-48539984 TGTAGCAAACAGATGTACAGAGG + Intergenic
1008224101 6:48890900-48890922 GGGAAGAGACAGATGGACATGGG + Intergenic
1011570619 6:88730439-88730461 GTGAGCACACAGTTGGACAAGGG - Intronic
1012487688 6:99740256-99740278 GGGAGCTTCCAGATTGCCAGAGG - Intergenic
1019268827 7:134555-134577 GGGGGCATAAAAATGGTCAGTGG - Intergenic
1019940040 7:4282585-4282607 GGGAGCAGACACTTGGAGAGAGG - Intergenic
1021726027 7:23548852-23548874 GGCATCATACAGATGGACACTGG + Intergenic
1025994439 7:66519000-66519022 GGGTGCCTACAGGTGGACGGTGG + Intergenic
1026321123 7:69268412-69268434 GAGAGGATAGAGAGGGACAGAGG - Intergenic
1027569533 7:79847140-79847162 AGGAGCATCCAAATGGAGAGAGG + Intergenic
1029121364 7:98270464-98270486 GGGACCGGACAGATGGCCAGGGG - Intronic
1029968224 7:104762878-104762900 GGCAGCAAGCACATGGACAGAGG + Intronic
1030058509 7:105603813-105603835 AGGGGCAGAGAGATGGACAGAGG - Intergenic
1030679004 7:112414485-112414507 GGGAGCAGACACATGGCCACTGG + Intergenic
1031049916 7:116934724-116934746 GGGAGGATAGAGAGGGACGGAGG - Intergenic
1033006622 7:137571817-137571839 AGAAGAATACAGATGGAAAGAGG + Intronic
1036531262 8:9589940-9589962 TGGAGCATGCACATGAACAGAGG - Intronic
1038217579 8:25576905-25576927 GGAAGCAGACAGAAAGACAGTGG - Intergenic
1039180036 8:34856740-34856762 GAGAGCATTCAGATACACAGAGG + Intergenic
1039348213 8:36731692-36731714 GGGTGCAAACACATGGACACAGG + Intergenic
1040484839 8:47860219-47860241 AGGAGCATATAGAGGGATAGTGG + Intronic
1043573978 8:81635854-81635876 ATGTGCATACATATGGACAGAGG + Intergenic
1044786863 8:95803484-95803506 GGGAGCATGCACATGAGCAGAGG + Intergenic
1051889833 9:21930422-21930444 GGGAGTATAAAGATGTCCAGGGG - Intronic
1052576940 9:30303010-30303032 GGGAGCAGAATGATGAACAGTGG + Intergenic
1053580489 9:39399173-39399195 GGGAGCATACAGACAGGCTGTGG - Intergenic
1053844985 9:42227251-42227273 GGGAGCATACAGACAGGCTGTGG - Intergenic
1054102076 9:60957978-60958000 GGGAGCATACAGACAGGCTGTGG - Intergenic
1056233595 9:84570619-84570641 CTGAGCAAACAGATGGCCAGAGG - Intergenic
1056269519 9:84933317-84933339 GGGAGCACACCAAAGGACAGAGG - Intronic
1057195638 9:93114561-93114583 GGGTGCACACAGATGGACAGGGG - Intergenic
1057437270 9:95053218-95053240 GGAAGCAGAAAAATGGACAGAGG + Intronic
1057543141 9:95994637-95994659 TGGAGTATACAGATGAGCAGGGG + Intronic
1057828967 9:98392806-98392828 ATGAGTAGACAGATGGACAGTGG - Intronic
1058078403 9:100674225-100674247 GGGTGAAAACAGATGGAAAGGGG + Intergenic
1058311883 9:103514557-103514579 GGGAGCATACAAAAGGGCAGAGG + Intergenic
1058825705 9:108774467-108774489 GGAAGCTTACAGATGGGCATGGG - Intergenic
1058978843 9:110150395-110150417 GGCAGCATACAGAACGAAAGAGG - Intronic
1060250395 9:121982381-121982403 GGGAGGTGACATATGGACAGGGG + Intronic
1061279230 9:129587540-129587562 GGGAGAAGACAGCTGTACAGTGG + Intergenic
1061800072 9:133108938-133108960 GGTGGCCTTCAGATGGACAGGGG - Intronic
1062158318 9:135066397-135066419 GGGAGGAGACACATGCACAGGGG + Intergenic
1186601390 X:11041543-11041565 GGGAGCATACAGAAAAGCAGTGG + Intergenic
1187500952 X:19838294-19838316 GGAAGCAGCCAGAGGGACAGTGG + Intronic
1189186817 X:39061990-39062012 GGGCGGATGCAGATGGAGAGAGG - Intergenic
1193145959 X:78076006-78076028 GTGAGCATACACCTGGACAAGGG + Intronic
1194324811 X:92501260-92501282 AGGACCATACAGATTCACAGTGG + Intronic
1195433205 X:104812592-104812614 GGAGGCATACAGGTGGAGAGGGG + Intronic
1195699106 X:107689032-107689054 GGTAGCATATAGATGGAGGGGGG + Intergenic
1198438703 X:136640989-136641011 GGGAGCATGCAGAAGGAGTGAGG - Intergenic
1199019992 X:142868173-142868195 GAGAGCATGCAGATGGACTGGGG + Intergenic
1200633544 Y:5620436-5620458 AGGACCATACAGATTCACAGTGG + Intronic