ID: 1090968449

View in Genome Browser
Species Human (GRCh38)
Location 11:131618599-131618621
Sequence GCTCACATCCTGATGTTACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 111}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090968449_1090968454 13 Left 1090968449 11:131618599-131618621 CCCAGTAACATCAGGATGTGAGC 0: 1
1: 0
2: 0
3: 11
4: 111
Right 1090968454 11:131618635-131618657 TCCCCTATGCTCAGATAAGATGG 0: 1
1: 0
2: 0
3: 6
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090968449 Original CRISPR GCTCACATCCTGATGTTACT GGG (reversed) Intronic
901899029 1:12342123-12342145 GCTCACATCCTTAATTTGCTTGG - Intronic
904517016 1:31064613-31064635 GCTCAATTCCTGTTATTACTGGG - Intronic
909162773 1:72174702-72174724 GCTTGCATCCTAATGTTAATGGG + Intronic
909728822 1:78869945-78869967 TTTCACATCCAGATGATACTTGG + Intergenic
911690998 1:100834812-100834834 TCTCACATACTGATGATACCAGG - Intergenic
912088424 1:106039698-106039720 GTACCCATCCTGATGTTATTTGG - Intergenic
914385175 1:147162209-147162231 GCTCTGATCCTGATTTTATTAGG + Intronic
918509908 1:185300371-185300393 TCTAACATCCTGAAGTTACGAGG + Intronic
922196807 1:223365474-223365496 TCTCACATACTGATGGTAGTTGG + Intergenic
1062946615 10:1466430-1466452 GCCCACATCCTGGAGATACTTGG - Intronic
1063461776 10:6219386-6219408 AGTCACAGCCTGATGTTACATGG - Intronic
1064781892 10:18849996-18850018 GCTGTCATCCTGATATTAATGGG + Intergenic
1065414192 10:25466808-25466830 ACACACACCCTGGTGTTACTAGG + Intronic
1065977718 10:30857947-30857969 GCTCACTTCCTGATGTCCATTGG + Intronic
1067553805 10:47253911-47253933 GCTCAGACCCTGCTGTTTCTGGG + Intergenic
1068927767 10:62557741-62557763 TCTCCCATCCTGATTTTGCTGGG - Intronic
1071791158 10:88955744-88955766 CCTCACATCCTCATGTTGCATGG - Intronic
1077543371 11:3158104-3158126 GCCCACATCCTGACGTTTCTAGG + Intronic
1079339410 11:19599648-19599670 GCTCACATCCTAAGGTTTCAAGG + Intronic
1081151062 11:39633252-39633274 GTTCACATCTTGATATTAATTGG + Intergenic
1088875925 11:113936146-113936168 GCTCTCACCCTGCTGTTTCTGGG - Intronic
1090968449 11:131618599-131618621 GCTCACATCCTGATGTTACTGGG - Intronic
1092767122 12:11862748-11862770 GATCACATCCTGAGGGTACTAGG + Intronic
1092930814 12:13314072-13314094 GATGACATCCTGAAGTCACTTGG + Intergenic
1100659977 12:96686351-96686373 GTTCACAATCTGAGGTTACTGGG + Intronic
1101570419 12:105948452-105948474 GCTGTCATCCTGTGGTTACTTGG + Intergenic
1103744688 12:123114499-123114521 GCTCATTTCCTGGCGTTACTGGG - Intronic
1104607768 12:130202640-130202662 GATCACATTCTGAGGTTACAGGG + Intergenic
1106968984 13:35112905-35112927 GCTAACTTCCTGATATTAATGGG - Intronic
1108522404 13:51258275-51258297 GGTCATATTCTGAGGTTACTAGG + Intronic
1108970986 13:56376472-56376494 CTTCAAATCCTGATGTTATTTGG - Intergenic
1112328214 13:98458013-98458035 GCTTACTTCCTAATGTTAATGGG + Intronic
1115888074 14:37995711-37995733 GGTCACATTCTGAGGTTACTAGG + Intronic
1116627736 14:47287746-47287768 CCTCACAACGTGATGTTACTCGG + Intronic
1120133193 14:80831902-80831924 GCTTACATCCTGATGTGGTTTGG + Intronic
1125732348 15:41900311-41900333 GCTCACTTCCTGTGGTTCCTGGG + Exonic
1127018279 15:54713672-54713694 GTACTAATCCTGATGTTACTGGG - Intergenic
1128968356 15:72084505-72084527 ACTGACATCATGATGTTACCTGG + Intronic
1131090683 15:89622713-89622735 GCACCCAGCCTGATGTTGCTGGG - Intronic
1131489317 15:92848916-92848938 GGTCACATTCTGAGGTCACTGGG - Intergenic
1134191987 16:12128760-12128782 GCTTATATCCTGATGTCACGTGG + Intronic
1134790629 16:16986359-16986381 GCTTATATCCTGAGGTTTCTGGG - Intergenic
1134859580 16:17549134-17549156 GATTACATCCTGATGGTACTGGG + Intergenic
1135652601 16:24219108-24219130 GCCCACATTCTGATGTTCCCTGG + Exonic
1137556677 16:49474680-49474702 ACTCACCTCCTGCTCTTACTGGG - Intergenic
1140530600 16:75662495-75662517 GCTCTCATCCTGAAGCTACTAGG + Intronic
1140536764 16:75716782-75716804 GCTTTCATCCTGAAGCTACTAGG + Intronic
1141307755 16:82882350-82882372 ACTCACTTCCTGAAGTCACTGGG + Intronic
1144382925 17:14720579-14720601 AGTCACATTCTGAAGTTACTAGG + Intergenic
1147196204 17:38768470-38768492 GATCACATCCTCATGTAACTAGG + Exonic
1150721507 17:67617920-67617942 GGTCACATTCTGAGGTTCCTGGG + Intronic
1156682572 18:39608884-39608906 GCTGACATCATGCTGTTTCTTGG + Intergenic
1157628849 18:49076550-49076572 GTTCACATCCTGATGACACCTGG + Intronic
1158849038 18:61475464-61475486 TCTCACTTCCAGAAGTTACTAGG + Intronic
1165617951 19:37218726-37218748 TCTCACATTCTCACGTTACTGGG - Intronic
926906792 2:17813186-17813208 GCTCTCAGCCAGATTTTACTGGG + Intergenic
927600548 2:24436595-24436617 ACTCCCATCCTGAAGTTAGTAGG + Intergenic
937423522 2:121778223-121778245 GCTGTCATCGTGATGTTCCTTGG - Intergenic
939776234 2:146391839-146391861 GCTCACATGCTATAGTTACTAGG + Intergenic
939894580 2:147776105-147776127 ACTCAAATACTTATGTTACTTGG - Intergenic
941267051 2:163375230-163375252 GCTCACTTCCTTAAGTTGCTAGG + Intergenic
944417438 2:199492946-199492968 GCTGACCTGCTCATGTTACTTGG - Intergenic
946455386 2:219821281-219821303 GCTCAGATCTTCATGCTACTCGG + Intergenic
1175506417 20:59488464-59488486 GCTATTATCCTGATGTTACCAGG - Intergenic
1175506635 20:59490558-59490580 GCTATTATCCTGATGTTACCAGG + Intergenic
1177251148 21:18592711-18592733 GTTTACAGCCTTATGTTACTGGG + Intergenic
1181385261 22:22540428-22540450 AGTCACATTCTGAGGTTACTGGG + Intergenic
1181447977 22:22993249-22993271 GGTCACGTCCTCATGTGACTAGG + Intergenic
1182773593 22:32814011-32814033 GCTCATTGCCTGATGTTAGTAGG + Intronic
949900858 3:8813800-8813822 GCTGGCTTCCTGATGCTACTGGG + Intronic
950633287 3:14298256-14298278 GCTGACATCATGGTGTTGCTAGG - Intergenic
952053892 3:29420421-29420443 GGTCACATCCTGATGGGATTTGG + Intronic
952096764 3:29963240-29963262 GCTCACATGGTGATTTTACTAGG - Intronic
955514190 3:59710385-59710407 GTGCACATCCTGCTGTTAATTGG - Intergenic
957453179 3:80405912-80405934 GCTCACATCGTCATGTTGCTTGG + Intergenic
963632985 3:147757155-147757177 GCTCACATTCTGCTGTTATTAGG + Intergenic
969438429 4:7201964-7201986 GTTCACATCCTGCTTTTTCTTGG + Intronic
969937104 4:10693266-10693288 GGTCACATTCTAATGTAACTGGG - Intergenic
969984260 4:11190779-11190801 GCTCCCATTCTCATTTTACTTGG - Intergenic
970837096 4:20422545-20422567 GCTTACATCCTAATGTTAACAGG + Intronic
972696321 4:41450077-41450099 GGTCACATTCTGAAGGTACTGGG + Intronic
976217257 4:82727073-82727095 TCTCACATCTTGAGGTTCCTGGG + Intronic
976579865 4:86723281-86723303 GCTCACCTCCTGCTGTGACCAGG - Intronic
977966045 4:103149592-103149614 GTTCACATTCTGAGGTTCCTGGG - Intronic
979797814 4:124869248-124869270 TCTCTCATCCTGATGTTGCTAGG - Intergenic
980113293 4:128655042-128655064 CCTCTCATCCTTTTGTTACTTGG + Intergenic
984177563 4:176438021-176438043 CCTCACATCCTAGTGTGACTTGG + Intergenic
984885998 4:184449942-184449964 TCTCACATCCTGGTGTTTCCAGG - Intronic
992647283 5:78823221-78823243 GCTCACATAATGATGACACTGGG + Intronic
999899889 5:156075517-156075539 CCTTAAATCCTGATGTTCCTGGG - Intronic
1004912980 6:20304715-20304737 TCTCACATCCTGCTATCACTTGG - Intergenic
1005510328 6:26506724-26506746 GCTGTCATCCTGATGGTTCTAGG + Exonic
1005579349 6:27218654-27218676 ACTCACAATCTTATGTTACTGGG + Intergenic
1011471102 6:87708672-87708694 GCTGAAATCCAGATTTTACTGGG + Intergenic
1012581837 6:100879438-100879460 GCCCCCATCCTGAAGCTACTAGG + Intronic
1021783948 7:24134143-24134165 GCTCACATCCCCATCTTCCTTGG + Intergenic
1022174473 7:27860420-27860442 GCTCACATCTTTATCTTCCTTGG + Intronic
1024098523 7:46005843-46005865 CCTCACATCCTGCTGTAAGTGGG + Intergenic
1028081499 7:86583637-86583659 GCTCACAAACTGAAGTTCCTGGG + Intergenic
1028526018 7:91787530-91787552 CCTCACATCCTGATTATATTTGG - Intronic
1029023511 7:97390285-97390307 GCTAACATTTTGATGTTAATAGG - Intergenic
1031564840 7:123283145-123283167 GCTGGCATCCTGAGGTCACTGGG - Intergenic
1031660369 7:124416726-124416748 GCTCAAATCCTGTAGTTTCTAGG + Intergenic
1032511098 7:132473010-132473032 GCCCACATCAGGATGTTACGTGG + Intronic
1035086906 7:156267770-156267792 GCTCACATTCTGGTTTTGCTTGG + Intergenic
1036196296 8:6718571-6718593 GCAAGCATCCTGATTTTACTGGG + Intronic
1042103911 8:65303997-65304019 GCCCACATCCTAATGCTACAGGG + Intergenic
1046372420 8:113327173-113327195 GCTGACATCCTGCTGTTATGAGG + Intronic
1057219341 9:93247655-93247677 GCCCACATCCTGCTGCTCCTTGG - Exonic
1058194728 9:101958129-101958151 CCTCAAATCCTGAGGTTCCTGGG + Intergenic
1059489219 9:114653376-114653398 GCTGAGATCCAGATGTTGCTGGG + Intergenic
1062291500 9:135797299-135797321 GCTCCCATCCAGCTGTTCCTGGG + Intergenic
1188621666 X:32233314-32233336 GGTCTGATGCTGATGTTACTGGG + Intronic
1189207807 X:39256900-39256922 CCTCACATCCTGATTTATCTTGG + Intergenic
1190972014 X:55358578-55358600 CCTAACATCATGATGTTAGTTGG - Intergenic
1191160209 X:57321781-57321803 GCTGTCATCATGTTGTTACTTGG + Intronic
1191955227 X:66636764-66636786 ACTCACATCATGGTGTTATTGGG - Intronic
1192079239 X:68031650-68031672 ACTCACATCCTGATGGCTCTGGG + Intergenic
1192570811 X:72202970-72202992 GCCCCCATCCTGAAGCTACTAGG - Intronic
1193406598 X:81108556-81108578 CCTGACATCAGGATGTTACTTGG + Intergenic
1194735096 X:97503317-97503339 GCTCACATCCTGAGGTCTCCAGG + Intronic
1199825655 X:151497163-151497185 GTGCAAATTCTGATGTTACTGGG + Intergenic
1200294628 X:154906631-154906653 CCTCACATCCTCATTTTCCTAGG + Intronic