ID: 1090968902

View in Genome Browser
Species Human (GRCh38)
Location 11:131622797-131622819
Sequence TGCTCAGCTTGTTAGCTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 84}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090968902_1090968907 9 Left 1090968902 11:131622797-131622819 CCCTTGAGCTAACAAGCTGAGCA 0: 1
1: 0
2: 2
3: 6
4: 84
Right 1090968907 11:131622829-131622851 ACCCTCCAGGAGTGCTCCTTGGG 0: 1
1: 0
2: 0
3: 6
4: 116
1090968902_1090968904 -4 Left 1090968902 11:131622797-131622819 CCCTTGAGCTAACAAGCTGAGCA 0: 1
1: 0
2: 2
3: 6
4: 84
Right 1090968904 11:131622816-131622838 AGCAATCGCACCGACCCTCCAGG 0: 1
1: 0
2: 0
3: 1
4: 44
1090968902_1090968910 12 Left 1090968902 11:131622797-131622819 CCCTTGAGCTAACAAGCTGAGCA 0: 1
1: 0
2: 2
3: 6
4: 84
Right 1090968910 11:131622832-131622854 CTCCAGGAGTGCTCCTTGGGTGG 0: 1
1: 0
2: 1
3: 20
4: 171
1090968902_1090968906 8 Left 1090968902 11:131622797-131622819 CCCTTGAGCTAACAAGCTGAGCA 0: 1
1: 0
2: 2
3: 6
4: 84
Right 1090968906 11:131622828-131622850 GACCCTCCAGGAGTGCTCCTTGG 0: 1
1: 0
2: 1
3: 12
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090968902 Original CRISPR TGCTCAGCTTGTTAGCTCAA GGG (reversed) Intronic
903868756 1:26417185-26417207 TGCTCAGCCTGTCTGCCCAAAGG - Intronic
908550290 1:65201902-65201924 TGCTCATATTTTTAGCTCCAGGG - Intronic
908647226 1:66291288-66291310 TGCTCTGCTTGTTAGCTTCTTGG - Intronic
908797448 1:67845179-67845201 TGCACAGCTGGTTAGGTCAGTGG - Intergenic
913319519 1:117578550-117578572 GGCTCAGTTTGTTAGATGAATGG + Intergenic
919760680 1:201096195-201096217 TCCTCAGCCTGTTAGCTCCAAGG + Intronic
923076916 1:230617884-230617906 TTCTGAGCTGGTTAGCTGAAGGG - Intergenic
1062786948 10:272566-272588 TGCCCAGCTTGCTTGCTCTAGGG - Intergenic
1069652903 10:70064032-70064054 CTCTCAGATTGTTAGCTTAAGGG - Intronic
1074565688 10:114575680-114575702 TGCTCACCCTGTGATCTCAATGG + Intronic
1076149572 10:128151192-128151214 TGCACCGCTGGTTAGCTAAAAGG - Intergenic
1076301592 10:129432444-129432466 TGCAAAGCTTGTTAAGTCAATGG + Intergenic
1080777964 11:35403915-35403937 GGCTCAGCAGCTTAGCTCAAAGG + Intronic
1085927267 11:81037280-81037302 TGCCCAGATTGTCAGCTCACAGG + Intergenic
1088299713 11:108344050-108344072 TGCTCTGTTTATTAGCTCACTGG - Intronic
1090467671 11:126949556-126949578 TGCTCAGCTTCTGATCTCCAAGG - Intronic
1090968902 11:131622797-131622819 TGCTCAGCTTGTTAGCTCAAGGG - Intronic
1093742585 12:22705339-22705361 TGCTCATCATGTTAGCCCTAGGG - Intergenic
1098083806 12:66819242-66819264 TACTGAGCTTATTAGCTGAAAGG - Intergenic
1099277715 12:80599095-80599117 TGCTGAGTGTGTTAGCTCAAAGG - Intronic
1100889945 12:99114308-99114330 TGTTCAGCTCGTTAGCCCAGAGG + Intronic
1101811480 12:108111747-108111769 TGCTCAGCTGGTGGGCTCAGGGG - Intergenic
1106296198 13:28416037-28416059 TGCTAAGTTTGTTTGCTGAAAGG - Intronic
1115630962 14:35244959-35244981 TGCTCAGCTTATCTTCTCAAGGG - Intronic
1117661649 14:58012506-58012528 TTCTCAGTTTGTAAGCTCAGTGG + Intronic
1123768848 15:23509082-23509104 TCCTCAGTTTCTTAGCTGAAAGG - Intergenic
1124392949 15:29276552-29276574 CCCTCAGCTTGTGAGCTCAGAGG - Intronic
1126817233 15:52466064-52466086 TGCTCCGCATGTTAGATCTAGGG - Intronic
1131616732 15:94024087-94024109 TGCCAAGCTTGTTAGCTTCAGGG + Intergenic
1133706742 16:8361942-8361964 TGCTCAGATTATTGTCTCAAGGG - Intergenic
1134375275 16:13666304-13666326 TGCTCAGCACGTAAACTCAATGG - Intergenic
1135656481 16:24255123-24255145 TGCTTTGCTTGTTAGTCCAAAGG - Intergenic
1136251177 16:29006235-29006257 TTCTTAGCATGTTAACTCAAAGG - Intergenic
1137678159 16:50314517-50314539 TGCTGAGCTTGTCAGATCAGAGG - Intronic
1139392738 16:66615372-66615394 GGCTCAGCTAGTTTACTCAAGGG + Exonic
1145740383 17:27269111-27269133 TTCTCAGCTTGGTAGCTGGAAGG + Intergenic
1150576434 17:66434710-66434732 TCCTCGGCTTGTTAGCTGCATGG + Intronic
1151541791 17:74768319-74768341 GGCTCAGCATGTGACCTCAAAGG - Intronic
1158988639 18:62845885-62845907 TGGTAGGCTTGTTAGATCAAAGG - Intronic
1163583033 19:18149459-18149481 TGCCCAGCTTGTCAGCTGACTGG - Exonic
1164259456 19:23556958-23556980 TGCTCAGCTTGCCAGCTTACAGG + Intronic
929948325 2:46387425-46387447 TTGTTAGCTTGTTAGCTCACTGG + Intergenic
932338730 2:70946109-70946131 TGCTCAGCATGTTTGCTCAAAGG + Intronic
935597912 2:104894074-104894096 TGCTCTGCTAGTCAGCTCCATGG + Intergenic
936561685 2:113543975-113543997 TCCTCAGCTTCTTACTTCAATGG + Intergenic
942780890 2:179641480-179641502 ACTTCAGCTTGTTAGTTCAAGGG + Intronic
942807084 2:179943864-179943886 TGCTCAGCTTGTAAGTTCTGTGG + Intergenic
1173799666 20:45887043-45887065 TGCTCAGCTTTCTGGCTCAGTGG + Exonic
950775361 3:15345281-15345303 TGCCCAGCTGCTTAGCACAAGGG - Intergenic
952310832 3:32188095-32188117 AGCTCAGCTTGTTTGCTAAAAGG - Intergenic
953019205 3:39103277-39103299 TGCTCAGCTTCTGAGCTCTGTGG - Intronic
953511638 3:43546924-43546946 TGCTCAGCTTCTTAGATCTGTGG - Intronic
962172387 3:133115499-133115521 TTCTCAACTTGTTAGCTGACTGG - Intronic
963194822 3:142515361-142515383 TGTTCAGTTTGTTAACTGAATGG - Intronic
970522422 4:16899078-16899100 TGCTAAGCTTGTTAGCATAGAGG + Intergenic
970936064 4:21571199-21571221 TGCTCAGCCTGTCATCTCAGAGG - Intronic
976445559 4:85126904-85126926 TGCCCAGATTGCCAGCTCAAAGG - Intergenic
976466091 4:85370230-85370252 TGCTCAGCCTGCTAGCCCAGTGG + Intergenic
976990666 4:91360960-91360982 AGCTCAGCTTTTTATCTCAAAGG - Intronic
977172152 4:93776475-93776497 TGCCCAGCTGTTTAGCACAATGG - Intergenic
981667914 4:147250819-147250841 TGATTAGTTTGTTAGCTTAATGG - Intergenic
982668734 4:158295894-158295916 TGCTCAGATTGCCAGCTCACAGG + Intergenic
984489981 4:180421634-180421656 TGCTGGGTTTGTTAGCTGAAAGG + Intergenic
985627296 5:995682-995704 TGCTGAGGTTGTGAGCTCCAGGG + Intergenic
987578121 5:19756652-19756674 TCCTTAGCTTGTTGGCTTAAAGG + Intronic
988894390 5:35656264-35656286 TGGTCTGCTTGTTCGCTGAAAGG + Intronic
996319306 5:122196349-122196371 TGTCCAGCTTATTAGTTCAAAGG + Intergenic
998163403 5:139826405-139826427 TGCTCTGCTTCTCATCTCAAGGG - Intronic
1001276891 5:170357858-170357880 TGCTCAACTTGTTTTCTTAAGGG + Intronic
1009192618 6:60647889-60647911 TGTTCAGATTGTTGGCTCTAGGG - Intergenic
1009835167 6:68991205-68991227 TGCTTAGGTTGTTAGGTCATAGG - Intronic
1013070898 6:106728405-106728427 GGCTCAGCTTGTAGCCTCAAGGG - Intergenic
1020707375 7:11562430-11562452 TGCTCAGCTGTTTTGCTAAATGG - Intronic
1021689406 7:23217532-23217554 ATCTCAGCTTGTTAGCTGAGTGG + Intergenic
1031997660 7:128243239-128243261 TGCTCAGTTTGTTAGCTCTATGG + Intronic
1036102261 8:5800260-5800282 TGCTCAGATTGCCAGCTCACAGG - Intergenic
1043704558 8:83331889-83331911 TGCTCAGGGTGTTAGATCAAAGG - Intergenic
1045565562 8:103311037-103311059 TGGACAGCTTGTAAGATCAATGG + Intronic
1048351241 8:133618432-133618454 AGCTAAGCTTATTAGCTCATAGG - Intergenic
1049890997 9:71343-71365 TCCTCAGCTTCTTACTTCAATGG - Intergenic
1053732459 9:41072540-41072562 TCCTCAGCTTCTTACTTCAATGG - Intergenic
1054695991 9:68359178-68359200 TCCTCAGCTTCTTACTTCAATGG + Intronic
1056649593 9:88446932-88446954 TGTTGAGCTTGTTAGCTCTGTGG + Intronic
1057422490 9:94923576-94923598 TGCTCAGATTTTTGGCTGAAGGG + Intronic
1060067890 9:120519934-120519956 TGGTCAGCATGCTAGTTCAATGG + Intronic
1189591822 X:42521035-42521057 TGCTCTTCTTTTTAGCTGAATGG - Intergenic
1189668811 X:43385912-43385934 TGCTCAGATTATTTGTTCAATGG + Intergenic
1191197373 X:57738994-57739016 TGCAGAGCTTTTTAGCTCAAGGG + Intergenic
1191773017 X:64782989-64783011 TGCTCAGATTGCCAGCTCACAGG - Intergenic
1196083845 X:111662312-111662334 TCATCAGATTGTTAGTTCAACGG - Intergenic
1197097644 X:122614294-122614316 TCCTCAGTTTCTTAGCTGAAAGG + Intergenic
1198146098 X:133859115-133859137 TGCTAAACTTATTAGATCAAAGG - Intronic
1200124633 X:153807470-153807492 TGCTCTGCTTGTGCTCTCAAGGG + Intronic