ID: 1090972214

View in Genome Browser
Species Human (GRCh38)
Location 11:131653594-131653616
Sequence CAAACTGTGAGATGTTTAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 126}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090972206_1090972214 19 Left 1090972206 11:131653552-131653574 CCCCTGCCACAGTGGCTGAGTGG 0: 1
1: 0
2: 2
3: 26
4: 257
Right 1090972214 11:131653594-131653616 CAAACTGTGAGATGTTTAGCAGG 0: 1
1: 0
2: 2
3: 12
4: 126
1090972205_1090972214 24 Left 1090972205 11:131653547-131653569 CCTCTCCCCTGCCACAGTGGCTG 0: 1
1: 1
2: 5
3: 69
4: 576
Right 1090972214 11:131653594-131653616 CAAACTGTGAGATGTTTAGCAGG 0: 1
1: 0
2: 2
3: 12
4: 126
1090972209_1090972214 17 Left 1090972209 11:131653554-131653576 CCTGCCACAGTGGCTGAGTGGAG 0: 1
1: 1
2: 1
3: 32
4: 322
Right 1090972214 11:131653594-131653616 CAAACTGTGAGATGTTTAGCAGG 0: 1
1: 0
2: 2
3: 12
4: 126
1090972212_1090972214 13 Left 1090972212 11:131653558-131653580 CCACAGTGGCTGAGTGGAGGGCA 0: 1
1: 0
2: 3
3: 20
4: 266
Right 1090972214 11:131653594-131653616 CAAACTGTGAGATGTTTAGCAGG 0: 1
1: 0
2: 2
3: 12
4: 126
1090972208_1090972214 18 Left 1090972208 11:131653553-131653575 CCCTGCCACAGTGGCTGAGTGGA 0: 1
1: 0
2: 3
3: 24
4: 197
Right 1090972214 11:131653594-131653616 CAAACTGTGAGATGTTTAGCAGG 0: 1
1: 0
2: 2
3: 12
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090972214 Original CRISPR CAAACTGTGAGATGTTTAGC AGG Intronic
900447743 1:2689899-2689921 CAAGCTGTGAGATGCTCACCTGG - Intronic
902997891 1:20241497-20241519 AAGACTGTGAGTTGTTGAGCGGG - Intergenic
908488246 1:64616696-64616718 CCAACTGAGAGATTTTAAGCAGG + Intronic
908636237 1:66168667-66168689 CCAACTGGAAGATGTTCAGCTGG + Intronic
908901259 1:68958990-68959012 CAAACTGTGAGGTCTTTAGAAGG - Intergenic
909518721 1:76542330-76542352 CAAACTGTGAGATGTCTTTAGGG + Intronic
910135938 1:83969995-83970017 CAAATTGTGACATGTGAAGCAGG - Intronic
910305815 1:85762417-85762439 TAAACTGAGACATGTCTAGCAGG - Intronic
911126451 1:94345146-94345168 CTAACTGAGAGATGATTTGCTGG + Intergenic
911437843 1:97885711-97885733 TTAACTGTGAGATCTTAAGCAGG - Intronic
914396618 1:147275673-147275695 CAAACTGTGAAAGGATTAGAAGG + Intronic
919034116 1:192283996-192284018 TAAACAGTGAGATGTTTTGGGGG + Intergenic
920235865 1:204504509-204504531 CAAACTGTGTGATCCTGAGCAGG - Intergenic
922888225 1:229036971-229036993 CAAACTGTGAGCTCCTTAGAGGG + Intergenic
1068882211 10:62062118-62062140 AAAACTGTGAGATGTTCAATGGG + Intronic
1069180301 10:65350768-65350790 CACACTGTGAGAGCTTCAGCTGG + Intergenic
1071913870 10:90268211-90268233 GAAACTGGGAGAAGCTTAGCTGG + Intergenic
1074264526 10:111888184-111888206 CACAGTGTGTGATGCTTAGCAGG + Intergenic
1077758382 11:5061358-5061380 TAAAATGTGGGATGTTTAACAGG + Intergenic
1079901334 11:26189885-26189907 AAAACTGTGAGATTCTAAGCAGG - Intergenic
1081217900 11:40424608-40424630 CACACTGTAAGATATTTAGCTGG - Intronic
1083245000 11:61419967-61419989 CAAACTGTGACAGGTTCTGCCGG + Exonic
1083644279 11:64163716-64163738 GAAACTGAGAGAAGCTTAGCTGG - Intronic
1088804817 11:113342632-113342654 CATACTCTGAGATGTTAAGTAGG + Intronic
1090972214 11:131653594-131653616 CAAACTGTGAGATGTTTAGCAGG + Intronic
1091681511 12:2530868-2530890 CTAACTGTGACATCTTTAGGGGG + Intronic
1091691092 12:2598041-2598063 CCTACTGTGAGATGTGGAGCTGG + Intronic
1093013543 12:14133396-14133418 CAGACTGTGAGAAATTTTGCAGG - Intergenic
1093648739 12:21618965-21618987 CAAACTGTGTTAAGTTTAGGAGG - Intergenic
1096134758 12:49190209-49190231 CTAACTGTGGGAATTTTAGCCGG + Intronic
1099271245 12:80513338-80513360 CAAACTGTGCGTTGTTCCGCTGG + Intronic
1100665204 12:96744306-96744328 CAGACTGTGTGATGTATAGATGG + Intronic
1102092870 12:110207850-110207872 CAAAATGTGAGATTTAAAGCAGG - Intronic
1102783849 12:115588030-115588052 CTAGCTGGGTGATGTTTAGCAGG - Intergenic
1105070070 12:133228857-133228879 CATTCTTTGAGAAGTTTAGCTGG - Intronic
1110892812 13:80711123-80711145 CAAACTTTTAGATGTTTTTCAGG + Intergenic
1115014776 14:28597285-28597307 AAACCTTTGGGATGTTTAGCAGG - Intergenic
1115304490 14:31919824-31919846 CAAACTGACAGTTGTTTAGATGG - Intergenic
1115800563 14:36988882-36988904 CAAACTATGTGATGTTTGGCAGG - Intronic
1117004725 14:51409042-51409064 CAAACTGTGGGATGGTGAGAAGG - Intergenic
1118613335 14:67558242-67558264 CAGACTGTGGGGTGTTTAGTTGG - Intronic
1121770828 14:96536295-96536317 TGAAATGAGAGATGTTTAGCAGG + Intronic
1124546024 15:30627237-30627259 TGAATTGTGGGATGTTTAGCGGG + Intronic
1124779547 15:32616627-32616649 TGAATTGTGGGATGTTTAGCGGG + Intronic
1128517203 15:68350030-68350052 CAAGCTGTGAGAACTTTGGCAGG + Intronic
1128529000 15:68431555-68431577 CAAACTTTGAGATGCTTCCCCGG + Intronic
1128621613 15:69156046-69156068 GAATCTGGGAGAGGTTTAGCTGG + Intergenic
1131914082 15:97243621-97243643 AAAACTGGCAGATTTTTAGCTGG - Intergenic
1133516792 16:6517227-6517249 CAAAATGCGAGCTGTTCAGCAGG - Intronic
1135428142 16:22357487-22357509 CAGACTGTGAGATGTCAAGGGGG + Intronic
1140866769 16:79068940-79068962 ACAACTGTGAAATGTTTGGCTGG - Intronic
1151831196 17:76552493-76552515 CAAAATGTGAGATTTTAGGCTGG - Intronic
1154041301 18:10859026-10859048 ATTACTGTGAGATATTTAGCTGG - Intronic
1156747752 18:40412900-40412922 CAATCTGTGAGATGTGTCCCTGG - Intergenic
1158203031 18:54960867-54960889 CAATCTGTTAGATGTTGAGGGGG - Intergenic
1159762385 18:72444378-72444400 CAACATTTGAGATGTTTAGCTGG + Intergenic
1160008325 18:75085052-75085074 CAAACGGAGAAATGATTAGCAGG - Intergenic
1161653835 19:5501072-5501094 ACAGCTGTGTGATGTTTAGCAGG - Intergenic
1164889975 19:31814908-31814930 CTAACTGTGAGTGGTTTAGCTGG - Intergenic
927009774 2:18891075-18891097 CAGACTGTGAGCTGTTTAAAAGG - Intergenic
928187904 2:29130975-29130997 CTAGCTGTGCGATGTTGAGCTGG + Intronic
933156754 2:78983973-78983995 CACACTGTAGGATGTTTAACAGG + Intergenic
937809886 2:126187418-126187440 CTAACTGAGAGTTGTATAGCAGG + Intergenic
946821253 2:223631902-223631924 CAAACTGTGGGATGTATACCAGG - Intergenic
946921826 2:224588149-224588171 CAAACTGTGAGATGTGAAAAAGG - Intergenic
947689554 2:232122103-232122125 CAAACTCTGTAATGTTTAACTGG + Intronic
1177687637 21:24459755-24459777 CTAACTGTGCAATGTTTCGCAGG - Intergenic
1178227860 21:30744655-30744677 CAAATGGTGAGCTGTTTAGTAGG + Intergenic
1182850967 22:33473923-33473945 CAAACTGTGGGATGGTGAGAAGG - Intronic
1183954554 22:41371595-41371617 CAAACCGTGAGATGCTGTGCTGG + Intronic
1184700162 22:46165580-46165602 CAAAGTTTGGGATGTTTACCAGG - Intronic
949322615 3:2827922-2827944 CAAAATGTGAGATTTTTAAATGG + Intronic
951590225 3:24256394-24256416 CAAACTTTCAGAAGTTTGGCTGG + Intronic
951730211 3:25802132-25802154 CATTCTCTGAAATGTTTAGCCGG + Intergenic
951887491 3:27538610-27538632 AAAAGCGTGAGATGTTTAGTGGG - Intergenic
952514643 3:34091613-34091635 CAAACTGAGAGAAATTCAGCAGG + Intergenic
959384888 3:105691736-105691758 GGAACTGCGAGATATTTAGCAGG - Intronic
962879150 3:139559694-139559716 CAAACACTGAGATGTTTTGCGGG + Intergenic
964193323 3:154032049-154032071 CAAACTGAGAGATGTACAACTGG - Intergenic
967251343 3:187543118-187543140 CAAAATGTGGAATGTTCAGCTGG + Intergenic
967920011 3:194607583-194607605 CAAACTGTGTGACCTTGAGCAGG + Intronic
969063101 4:4455061-4455083 CAAACTGTGTGACTTTGAGCAGG - Intronic
969084238 4:4643528-4643550 CACGCTGTGAGTTGTGTAGCTGG + Intergenic
970549964 4:17169803-17169825 CAAACTTTGAAATTTTTAACAGG - Intergenic
973256228 4:48116431-48116453 CAAACTGGGATATGTTGAGAAGG + Intronic
974817579 4:67025117-67025139 AAAACTGAGAGATGTTTATTAGG + Intergenic
975610783 4:76200725-76200747 CAGCCTGTGAGATGTTTAGATGG - Intronic
977627764 4:99206219-99206241 CACATTGTGGGAGGTTTAGCAGG + Intronic
979635274 4:122949589-122949611 CAAAAGGTGAGTTGTTTAGTGGG + Intronic
979805711 4:124968274-124968296 AAAACTGTGAGAGATTTAACAGG + Intergenic
979909749 4:126347789-126347811 GAAACTGAGAGATGTGTAGCTGG - Intergenic
986380275 5:7177891-7177913 CACTCTGTGAGATGCGTAGCAGG - Intergenic
988556713 5:32242802-32242824 CAAATTATGAGACGTGTAGCAGG + Intronic
991089701 5:62682446-62682468 CAAACTATGAGATTTTTAAATGG - Intergenic
991315508 5:65300459-65300481 CAAACTGTGTGATCTTTAGCAGG - Intronic
992467733 5:77023851-77023873 CAAAATGTAAGAATTTTAGCTGG + Intergenic
994318672 5:98363653-98363675 CAGACTGTGAGATGTGGAGGGGG + Intergenic
994911142 5:105909813-105909835 CTAGCTGTGGGATCTTTAGCAGG - Intergenic
995319905 5:110822609-110822631 CAAACTGTCCCATGTTTAACTGG + Intergenic
998203526 5:140143762-140143784 CAAGCTGTGAGGTGCTTATCAGG - Intergenic
998795429 5:145813129-145813151 CAAGCTGTGTGTTGGTTAGCAGG - Intronic
1000227805 5:159284249-159284271 CAAACTTGGACATGTTTTGCTGG - Intronic
1004059620 6:12180095-12180117 AAAAATGTGAAGTGTTTAGCAGG - Intergenic
1004229507 6:13818352-13818374 CCATCTGTGAGAAGTTTAGGTGG + Intergenic
1005013405 6:21356882-21356904 CAAAAGGTGAGATGTTTAGTGGG + Intergenic
1005400302 6:25425376-25425398 TATACTTTGAGATGTTTAACTGG + Intronic
1006739442 6:36296881-36296903 CTAACTGTGTGATATTGAGCAGG + Intronic
1008491172 6:52088657-52088679 GAAACTGAGAGAGGTTCAGCAGG - Intergenic
1010518718 6:76806593-76806615 CAAAATCTGAGATGTTTAGCAGG - Intergenic
1010985274 6:82416184-82416206 CAAACTCAGAGAAGTTAAGCGGG - Intergenic
1013333324 6:109128805-109128827 CAAACAATAAGAGGTTTAGCAGG - Intronic
1013594047 6:111645235-111645257 CAGACTGTGAGATGGTTGACAGG + Intergenic
1016381567 6:143488542-143488564 CAAACTGTGATAATATTAGCAGG - Intronic
1016903550 6:149126857-149126879 AAAACTATAAGATGTTTAGGGGG + Intergenic
1021226303 7:18030875-18030897 CAAAATGCTAGATGTTTAGGTGG + Intergenic
1022369381 7:29756681-29756703 CAAGCTGTGAGATGATCAGGAGG + Intergenic
1027975646 7:85151336-85151358 TAAACTTGGAGATGTTTACCTGG - Intronic
1029335746 7:99897909-99897931 CAACAGGTGAGATGTTTAGTGGG - Intronic
1031346891 7:120678164-120678186 TAAACTCTGAGATGGTTAGGGGG + Intronic
1031570079 7:123348372-123348394 GAGACTGTGAAAGGTTTAGCAGG - Intergenic
1032300803 7:130684780-130684802 CAAACTTTAAGATGTTAAGTTGG - Intronic
1036150537 8:6293250-6293272 CACACTCTGGGATGTTTAGCAGG - Intergenic
1038596562 8:28890998-28891020 GAAACTGTGAGGTGATTTGCAGG + Exonic
1043852502 8:85230779-85230801 GGAACTGTGAAATATTTAGCAGG + Intronic
1045496968 8:102717214-102717236 TATATTGTAAGATGTTTAGCAGG + Intergenic
1045682095 8:104672893-104672915 CAAACTGTGACAAGTCTAGTGGG + Intronic
1046745251 8:117869010-117869032 CAAAAAGTGAGATTTTTGGCAGG - Intronic
1047891622 8:129317973-129317995 AGAACTGTGAGATGTTTAATGGG + Intergenic
1050065661 9:1757181-1757203 GAAACTGTGAGATGATAAACAGG - Intergenic
1057059060 9:91987036-91987058 CAAACTTTGAGCAGTTTACCTGG + Intergenic
1057152069 9:92805156-92805178 GAAAGTGTGAAATGTTTTGCTGG + Intergenic
1057493054 9:95537634-95537656 CCGACTGTGAGATGTCTAGCTGG - Intergenic
1058100762 9:100915643-100915665 CAGAAGGTGAGATGTTTAGTGGG - Intergenic
1060028086 9:120190105-120190127 CAGCCTGTCAGATGTTGAGCTGG + Intergenic
1060616972 9:125025924-125025946 AAAACTGTGAGTTGTGTTGCTGG + Intronic
1185726699 X:2427368-2427390 CAATCTGTGATATGTTTCACAGG + Intronic
1189192165 X:39119692-39119714 CAAACTGTGAAATCTTTGCCAGG - Intergenic
1191916229 X:66204450-66204472 AAAATTTTTAGATGTTTAGCAGG - Intronic
1193369677 X:80679321-80679343 AACACTGTGAGATTTTAAGCTGG + Intronic
1195945515 X:110206640-110206662 CAAACTGTCAGAAGTTTACATGG - Intronic
1201366027 Y:13207114-13207136 CACTCTGTGGGATGTTTAACAGG - Intergenic