ID: 1090972555

View in Genome Browser
Species Human (GRCh38)
Location 11:131655778-131655800
Sequence TCATTGCCTCACACAGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 794
Summary {0: 1, 1: 1, 2: 5, 3: 28, 4: 759}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090972555_1090972558 22 Left 1090972555 11:131655778-131655800 CCAAGCTCTGTGTGAGGCAATGA 0: 1
1: 1
2: 5
3: 28
4: 759
Right 1090972558 11:131655823-131655845 AGAGAAATTCTAGTCTCCACTGG 0: 1
1: 0
2: 0
3: 8
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090972555 Original CRISPR TCATTGCCTCACACAGAGCT TGG (reversed) Intronic
900040543 1:459031-459053 TCATTGCCAGTCACAGACCTTGG + Intergenic
900061973 1:694002-694024 TCATTGCCAGTCACAGACCTTGG + Intergenic
900887339 1:5424223-5424245 ACAATGCCTCACACACAGCAAGG - Intergenic
901128494 1:6946440-6946462 TCTTAGCCTCACACAGTGCCAGG + Intronic
901315933 1:8308369-8308391 TCTTGGCCTCCCAAAGAGCTGGG - Intergenic
901418376 1:9133209-9133231 TCTTAGCCTCCCAAAGAGCTGGG - Intergenic
901633241 1:10658081-10658103 TCTTGGCCTCCCACAGTGCTGGG + Intronic
901888527 1:12241529-12241551 ACAGTGCCTCCCACAGAGCAGGG + Intronic
902173203 1:14629730-14629752 TCAGTGCCTGACTCAGAGGTGGG - Intronic
902906057 1:19558142-19558164 TCTTGGCCTCCCAAAGAGCTGGG + Intergenic
902935915 1:19764463-19764485 TCAGTGCCTCACACGGGGCCGGG + Intronic
902982856 1:20138247-20138269 TCTTGGCCTCCCACAGTGCTGGG + Intergenic
903297452 1:22353203-22353225 TCATGGCCTCCCAAAGTGCTGGG + Intergenic
903372862 1:22848028-22848050 CTAGTGCCTGACACAGAGCTGGG + Intronic
903389926 1:22956415-22956437 TCACTCCCACACACAGAACTGGG - Intronic
903394445 1:22988904-22988926 TCTTGGCCTCCCACAGTGCTGGG - Intergenic
903847367 1:26286378-26286400 CCAGTGCCTGACACAGATCTGGG - Intronic
904088569 1:27928619-27928641 CCTTTGCCTCACAAAGGGCTGGG + Intergenic
904202740 1:28831876-28831898 GCAATGCTTCACATAGAGCTTGG - Intronic
904262375 1:29296770-29296792 TCTTTGCCTCTCAAAGTGCTGGG + Intronic
904699450 1:32349749-32349771 ACAGTGCCTAACACATAGCTGGG - Intergenic
904743922 1:32699403-32699425 TCATGGCCTCCCAAAGTGCTGGG + Intronic
905049896 1:35041358-35041380 TCTTTGCCTCCCAAAGTGCTGGG - Intergenic
905128335 1:35732161-35732183 TCATCGCCTGGCACACAGCTTGG - Intronic
905788786 1:40779072-40779094 TCAGTGCCACACCCAGATCTGGG + Intergenic
905915433 1:41681342-41681364 TCTTAGCCTCACAAAGTGCTGGG + Intronic
906022538 1:42642838-42642860 TCATTGCCTCACTGAGGACTTGG + Intronic
906685965 1:47763622-47763644 TCAGTGCCTGGCACAGATCTGGG + Exonic
906686673 1:47767463-47767485 CCAGTGCTTCACACAGAGCCTGG - Intronic
906996267 1:50797448-50797470 CCATGGCCTCACAAAGTGCTAGG - Intronic
907251105 1:53140430-53140452 TCTGTGCCTGACACAGGGCTAGG + Intronic
907484261 1:54766212-54766234 CCAGCTCCTCACACAGAGCTTGG + Intergenic
907557883 1:55360521-55360543 TCTTGGCCTCCCACAGTGCTGGG + Intergenic
907671659 1:56479325-56479347 TCTTGGCCTCCCACAGTGCTGGG - Intergenic
908225659 1:62053467-62053489 TCTTGGCCTCCCACAGTGCTGGG - Intronic
908389814 1:63674319-63674341 TCAGTGCCTAGCACAGTGCTTGG + Intergenic
909044539 1:70693037-70693059 TCTTGGCCTCACAAAGTGCTGGG - Intergenic
910503077 1:87917135-87917157 GGAATGCCTCACATAGAGCTAGG + Intergenic
910696935 1:90029052-90029074 TCTTGGCCTCCCACAGTGCTGGG + Intronic
910970228 1:92848746-92848768 TCAGTGCCTCAAACAGTGCCTGG + Intronic
911468065 1:98280096-98280118 TAATTGCCTCACTTAGAGTTGGG + Intergenic
912137426 1:106679163-106679185 GCATTGCCTCCCAAAGTGCTGGG - Intergenic
915083384 1:153367311-153367333 TTATTGCCTAACACAGCACTGGG - Intergenic
915385199 1:155485006-155485028 TCTTGGCCTCACAAAGTGCTGGG - Intronic
915392257 1:155554657-155554679 CCTTGGCCTCCCACAGAGCTAGG + Intronic
915501307 1:156320153-156320175 CCTTTGCCTCACAAAGTGCTGGG - Intronic
916212900 1:162373027-162373049 TCTTTGCCTCCCTCAGGGCTTGG - Intronic
916514616 1:165504210-165504232 TCAGTGCCTAGCACAGAGCCTGG + Intergenic
917341989 1:173989437-173989459 TCTTGGCCTCCCACAGTGCTGGG + Intronic
917472794 1:175340240-175340262 TCATTGCCTCATGCACATCTGGG - Intronic
917538533 1:175892039-175892061 TCCTTGCCTCACACGGAGGCTGG + Intergenic
920136973 1:203777853-203777875 CCGTGGCCTCCCACAGAGCTGGG - Intergenic
920148352 1:203882665-203882687 TCTTGGCCTCACAAAGTGCTGGG - Intergenic
921544440 1:216457572-216457594 TCATTGTCTCACAGAGTGCATGG - Intergenic
922221146 1:223609556-223609578 TCAATGCCTCAAACAGGGCCTGG - Intronic
922623939 1:227018160-227018182 TCTTGGCCTCCCAAAGAGCTGGG + Intronic
923074431 1:230597081-230597103 TCATTAACTCACACAAAGCAGGG - Intergenic
923455428 1:234161508-234161530 CCTTGGCCTCACAAAGAGCTGGG - Intronic
923537465 1:234864068-234864090 TCATTGCCTCTCTGAGACCTGGG + Intergenic
923938354 1:238790737-238790759 TCAGTGCCTCATGAAGAGCTTGG - Intergenic
924186920 1:241502538-241502560 TCATTGCTTCACACTGAGTAGGG + Exonic
924227088 1:241930934-241930956 CCTTGGCCTCACAAAGAGCTGGG - Intergenic
924386802 1:243506712-243506734 TCAGTGTCTTACACAGAGCAGGG - Intronic
924863586 1:247953207-247953229 TCATTACCTCACAGAGTCCTTGG + Intronic
924868066 1:248007594-248007616 TCATTACCTCACAGAGTTCTTGG + Intronic
924872615 1:248065129-248065151 TCATTACCTCACAGAGTCCTTGG + Intronic
924932178 1:248741455-248741477 TCTTGGCCTCTCAAAGAGCTGGG + Intronic
1063568943 10:7196850-7196872 GCATAGCCTCAGACAGTGCTTGG - Intronic
1063717602 10:8544058-8544080 TCATTGCATCACCCAGAGCCCGG + Intergenic
1063731292 10:8700102-8700124 CCTTGGCCTCCCACAGAGCTGGG - Intergenic
1064252903 10:13720504-13720526 TCAGTGCCTGACACAGTGCCAGG - Intronic
1064293639 10:14057818-14057840 TCTTGGCCTCACAAAGTGCTGGG + Intronic
1064353060 10:14594561-14594583 TCGTAGCCTCACAAAGAGATTGG - Intronic
1064735006 10:18373064-18373086 CCATGGCCTCCCACAGTGCTAGG + Intronic
1064993426 10:21276220-21276242 CCATAGCCTCCCAAAGAGCTGGG + Intergenic
1065576769 10:27128652-27128674 TCTTTGCCTCCCAAAGTGCTGGG - Intronic
1065778724 10:29146511-29146533 TCTTTGCCTCCCAAAGTGCTAGG + Intergenic
1065848309 10:29764711-29764733 CCTTTGCCTCCCAAAGAGCTGGG + Intergenic
1066010966 10:31193085-31193107 TCATGGCCTCCCAAAGTGCTGGG + Intergenic
1066515917 10:36160315-36160337 CCTTGGCCTCACAAAGAGCTGGG + Intergenic
1066763265 10:38778320-38778342 ACATGGCCTCCCACAGGGCTGGG + Intergenic
1067022338 10:42812388-42812410 TCTTTGCCTCCCAGAGTGCTGGG + Intronic
1068198798 10:53755167-53755189 CCAGTGCCTCACATAGAACTTGG + Intergenic
1068432865 10:56955259-56955281 TCTTTGCCTCCCAAAGTGCTAGG + Intergenic
1068434956 10:56978579-56978601 GCCTTCCCTCCCACAGAGCTGGG + Intergenic
1068750724 10:60588668-60588690 TCTTGGCCTCCCACAGTGCTGGG - Intronic
1069871392 10:71535328-71535350 TGATTCCCTCACACAGGGCGTGG + Intronic
1070521215 10:77255347-77255369 TCATGGCCTCCCAAAGTGCTGGG - Intronic
1071675246 10:87649512-87649534 TCTCTGCCTCCCACAGTGCTGGG - Intergenic
1071832766 10:89388354-89388376 TCTTGGCCTCCCACAGTGCTGGG + Intronic
1072688094 10:97550609-97550631 CCACTGCCTCACACAGTGCCTGG - Intronic
1073090855 10:100937858-100937880 TCTTGGCCTCCCACAGTGCTAGG + Intronic
1073349743 10:102811133-102811155 TCAGTGGCTCACACCGGGCTCGG + Intronic
1073371999 10:102998725-102998747 GCTTTGCCTCCCAAAGAGCTGGG - Intronic
1074236700 10:111591802-111591824 CCATGGCCTCCCAAAGAGCTGGG + Intergenic
1074263372 10:111876049-111876071 TCAGTACCTAGCACAGAGCTTGG + Intergenic
1074282964 10:112070283-112070305 TCAATGCCTAGCACAGTGCTGGG + Intergenic
1074423016 10:113326068-113326090 TTATATCCTCCCACAGAGCTGGG - Intergenic
1075031480 10:119027557-119027579 TCTTGGCCTCACAAAGTGCTGGG - Intergenic
1075613743 10:123875586-123875608 TCATTGCATCACAGACAGTTTGG - Intronic
1075774356 10:124970510-124970532 CCTTGGCCTCACACAGTGCTGGG + Intronic
1076237184 10:128872316-128872338 TCATGCCCTCAGCCAGAGCTGGG - Intergenic
1076338010 10:129722753-129722775 CCATGGCCTCACAAAGTGCTGGG - Intronic
1076966816 11:95254-95276 TCATTGCCAGTCACAGACCTTGG + Intergenic
1077604916 11:3603131-3603153 CCTTGGCCTCACACAGTGCTAGG - Intergenic
1078290086 11:10001368-10001390 TCATTGCCTCATACTGAGAGGGG - Intronic
1078520524 11:12059418-12059440 TCTTGGCCTCCCACAGTGCTGGG + Intergenic
1081625696 11:44653936-44653958 TCATTGTCTCTCTCAGACCTTGG - Intergenic
1081859061 11:46321626-46321648 CCATGGCCTCCCACAGTGCTGGG + Intergenic
1081899227 11:46613731-46613753 CCATGGCCTCACACAGTGCTGGG + Intronic
1082018468 11:47510736-47510758 TCTTGGCCTCACAAAGTGCTGGG + Intronic
1082631393 11:55546194-55546216 CCATGGCCTCACAAACAGCTTGG + Intergenic
1083146807 11:60766128-60766150 TCTTGGCCTCCCACAGTGCTGGG - Intronic
1083403515 11:62440913-62440935 TCTTCGCCTCACAAAGTGCTGGG - Intronic
1084282177 11:68104852-68104874 TCTTTGCCTCCCAAAGTGCTGGG - Intronic
1084917686 11:72441687-72441709 TCTTGGCCTCCCACAGTGCTGGG + Intergenic
1085250974 11:75143798-75143820 TCATGGCCTCCCAAAGTGCTGGG - Intronic
1085741664 11:79082637-79082659 TCACTGCATCTCACAGAACTTGG - Intronic
1085757377 11:79212986-79213008 TCAGTGCCTGACACACAGATAGG - Intronic
1086014382 11:82149050-82149072 TCTTTGCCTCTCAAAGTGCTGGG - Intergenic
1086304331 11:85463526-85463548 TCTTGGCCTCCCAAAGAGCTGGG - Intronic
1086468777 11:87084545-87084567 TCTTGGCCTCACAAAGTGCTGGG + Intronic
1086867054 11:91992323-91992345 ACATTGCATCAGACAGAGATAGG - Intergenic
1087764328 11:102133545-102133567 TCTTGGCCTCCCACAGGGCTGGG + Intronic
1087767906 11:102176495-102176517 ACATTGCCTCCCAAAGTGCTGGG - Intronic
1088014861 11:105046052-105046074 TCTTGGCCTCCCAAAGAGCTGGG + Intronic
1088443627 11:109900402-109900424 TCTTTGCCTCTCAAAGTGCTGGG - Intergenic
1089549745 11:119264306-119264328 TCTTGGCCTCCCAAAGAGCTGGG + Intronic
1089557923 11:119325358-119325380 TCTTGGCCTCCCACAGTGCTGGG - Intergenic
1089754983 11:120679936-120679958 TCCTTGCCTCTCACATCGCTGGG + Intronic
1089919963 11:122199719-122199741 TCATTACCTAACACAGGGGTTGG + Intergenic
1090002208 11:122971508-122971530 TCTCTGCCTCCCACAGTGCTGGG - Intergenic
1090011672 11:123050824-123050846 TCTTGGCCTCCCACAGTGCTGGG - Intergenic
1090670134 11:128940200-128940222 TCATTGTCTCAAACAAAACTTGG - Intronic
1090775519 11:129961609-129961631 TCTTGGCCTCCCAAAGAGCTGGG - Intronic
1090855163 11:130604675-130604697 TCAGAGCCTAACACAGTGCTTGG - Intergenic
1090972555 11:131655778-131655800 TCATTGCCTCACACAGAGCTTGG - Intronic
1091670987 12:2452112-2452134 TCCTGGCCTCCCACAAAGCTGGG + Intronic
1091928829 12:4378228-4378250 TAAATGCCTCACACACAGCAAGG + Intronic
1092342261 12:7686813-7686835 TCTTGGCCTCACAAAGTGCTGGG + Intergenic
1092543551 12:9434750-9434772 CCATGGCCTCACCTAGAGCTTGG + Intergenic
1092605066 12:10109794-10109816 TCTTGGCCTCACAAAGTGCTGGG - Intronic
1092792411 12:12081422-12081444 TCATTATGTCACCCAGAGCTGGG - Intronic
1092823892 12:12379003-12379025 CCTTTGCCTCACAAAGTGCTTGG + Intronic
1092877039 12:12857338-12857360 TCTTGGCCTCCCAAAGAGCTAGG - Intergenic
1093811149 12:23493428-23493450 CCTTGGCCTCACAAAGAGCTGGG + Intergenic
1094606595 12:31954811-31954833 TCTCTGCCTCACAAAGTGCTGGG - Intergenic
1095507179 12:42910157-42910179 CCCTAGCCTCACACATAGCTGGG + Intergenic
1096291219 12:50344999-50345021 CCTTCGCCTCACACAGTGCTGGG - Intronic
1096454247 12:51772143-51772165 TCTTGGCCTCCCACAGTGCTGGG - Intronic
1097633789 12:62097124-62097146 TTTTTGCCTGACACAGTGCTTGG - Intronic
1097649677 12:62281587-62281609 TCTTGGCCTCCCACAGTGCTGGG + Intronic
1097792063 12:63825412-63825434 TCTTGGCCTCCCAAAGAGCTGGG - Intergenic
1097866420 12:64562876-64562898 CCCTTGCCTCACAAAGTGCTGGG + Intergenic
1099152676 12:79134743-79134765 TCCATGCCTAACACAGGGCTGGG + Intronic
1099556475 12:84114557-84114579 TCTTTGCCTCCCAAAGTGCTGGG - Intergenic
1099822139 12:87725763-87725785 TCTTTGCCTCCCAAAGTGCTGGG - Intergenic
1099837336 12:87923495-87923517 TCATTGCCTCCTGCTGAGCTAGG + Intergenic
1099940894 12:89187003-89187025 TCATGGCCTCCCAAAGTGCTGGG - Intergenic
1100442486 12:94629492-94629514 TCAGGGCCTCGCACAGTGCTGGG + Intronic
1100835773 12:98565511-98565533 TCTTGGCCTCCCAAAGAGCTGGG + Intergenic
1101499230 12:105286538-105286560 GAATTCCCTCACACAGAGATGGG - Intronic
1101890210 12:108706832-108706854 TCTTGGCCTCACAAAGTGCTGGG + Intronic
1102160538 12:110765045-110765067 TCTTTGCCTTCCACAGTGCTGGG + Intergenic
1102283305 12:111635258-111635280 TCTTTGCCTCCCAAAGTGCTGGG - Intergenic
1102738085 12:115181020-115181042 TCTCTGCCTCCCACAGTGCTGGG - Intergenic
1103204694 12:119119429-119119451 TCAGAGGCTCACCCAGAGCTTGG + Intronic
1103266287 12:119633327-119633349 TCTTTGCCTCCCAAAGTGCTAGG - Intronic
1103449526 12:121018616-121018638 TCTTGGCCTCCCACAGTGCTGGG - Intergenic
1103650643 12:122429522-122429544 TCTTTGCCTCCCAAAGTGCTGGG - Intergenic
1103987353 12:124776727-124776749 TCTTGGCCTCCCACAGGGCTGGG + Intergenic
1104286480 12:127429305-127429327 TCAGTACCTCAGACAGTGCTTGG - Intergenic
1104634281 12:130427906-130427928 TCAGTTCCTGGCACAGAGCTGGG + Intronic
1104662681 12:130622576-130622598 CCTTTGCCTCCCACAGTGCTGGG + Intronic
1104747522 12:131219606-131219628 TCACTGCCTCCCACTGACCTGGG - Intergenic
1104855059 12:131897673-131897695 TCTTGGCCTCCCACAGTGCTAGG - Intronic
1105205003 13:18215320-18215342 CCATGGCCTCCCAAAGAGCTGGG - Intergenic
1107159666 13:37211283-37211305 CCATGGCCTCCCAAAGAGCTGGG - Intergenic
1107595244 13:41956988-41957010 TCTTTGCCTCCCAAAGTGCTGGG - Intronic
1107623274 13:42256120-42256142 TCATTGCTTCACACTGAGTAGGG - Intronic
1108245993 13:48514753-48514775 TCCTTGCTTCACTCAGAGCAAGG + Intronic
1108526996 13:51293864-51293886 TCTCTGCCTCCCAAAGAGCTGGG + Intergenic
1108935371 13:55875241-55875263 GTATTGCATCACACAGAGCCTGG + Intergenic
1110550004 13:76801516-76801538 TCTTTGCCTCCCAAAGTGCTGGG - Intergenic
1110692226 13:78444147-78444169 CCATGGCCTCACAAAGTGCTGGG - Intergenic
1111487451 13:88922869-88922891 TCTCGGCCTCACAAAGAGCTGGG - Intergenic
1112879264 13:104085725-104085747 TCTTAGCCTCCCACAGTGCTGGG + Intergenic
1113798386 13:113073662-113073684 TCTTGGCCTCCCACAGTGCTGGG - Intronic
1115031159 14:28795510-28795532 TCTTTGCCTCTCAAAGTGCTGGG - Intronic
1115297205 14:31842174-31842196 TCTTGGCCTCCCAAAGAGCTGGG + Intronic
1115328908 14:32172319-32172341 TCGTTGCCTCCCAAAGTGCTGGG - Intergenic
1115599799 14:34944621-34944643 CCTTTGCCTCACAAAGTGCTGGG - Intergenic
1115629099 14:35225794-35225816 TCTTGGCCTCACAAAGTGCTGGG - Intronic
1115845191 14:37523675-37523697 TCAGTGCCTAACACAGTGCCTGG - Intronic
1116123966 14:40757565-40757587 TCCTTCCCTCCCACAGAGATTGG - Intergenic
1117467180 14:56005377-56005399 ACCTTGCCTCACACAGATATGGG - Intergenic
1117980450 14:61337675-61337697 TCATGGCCTCCCAAAGTGCTGGG + Intronic
1118494484 14:66294779-66294801 TCAGTGCCCTACACAGTGCTTGG + Intergenic
1119096161 14:71833656-71833678 CCATTGCCTAACAAAGGGCTTGG + Intergenic
1119816744 14:77575781-77575803 TCTTGGCCTCACAAAGTGCTGGG + Intronic
1119830706 14:77699803-77699825 TCCTTGCCTCCCAAAGTGCTGGG - Intronic
1119867462 14:77985752-77985774 TCTGTACCTCACACATAGCTGGG - Intergenic
1120711813 14:87800283-87800305 TCATTCTCTCACAGTGAGCTGGG - Intergenic
1120745740 14:88149676-88149698 TCATTGCTTGACACTCAGCTAGG - Intergenic
1120882915 14:89428628-89428650 TCTATGCCTCACACAGCGCCAGG + Intronic
1121090261 14:91176472-91176494 CCTTTGCCTCCCACAGTGCTGGG + Intronic
1121298312 14:92848385-92848407 TCTCTGCCTCCCAAAGAGCTGGG - Intergenic
1121331550 14:93052779-93052801 TCAGTCCCTCACTCAGAACTGGG + Intronic
1122429531 14:101631441-101631463 TTAATGCCTCAGACAGGGCTGGG - Intergenic
1122491499 14:102119102-102119124 TCCTCGCCTCCCAAAGAGCTGGG + Intronic
1122559993 14:102606310-102606332 TCTTGGCCTCCCACAGTGCTGGG + Intronic
1122655630 14:103257607-103257629 TCCTGGCCTCCCACAGTGCTGGG - Intergenic
1122683521 14:103486042-103486064 TCATGGCCTCCCAAAGTGCTGGG - Intronic
1123020934 14:105397648-105397670 TCAGTGCCTCGGCCAGAGCTGGG + Exonic
1124323221 15:28733427-28733449 TCTTGGCCTCCCACAGTGCTGGG - Intronic
1124453342 15:29818764-29818786 TCCTGGCCTCACAAAGTGCTGGG + Intronic
1124946060 15:34267596-34267618 CCATGGCCTCCCAAAGAGCTGGG - Intronic
1125104943 15:35959787-35959809 TCAATGCCTCACTCATATCTTGG - Intergenic
1126685958 15:51249189-51249211 CCATGGCCTCCCAAAGAGCTGGG + Intronic
1126967366 15:54070229-54070251 TCAGTGCCTCAAACACAGCAAGG - Intronic
1127559388 15:60120596-60120618 TAAGTGACACACACAGAGCTTGG - Intergenic
1129874805 15:78967050-78967072 TCTTGGCCTCCCAAAGAGCTGGG - Intronic
1131084064 15:89560540-89560562 TCACTGCCTCCCAAAGTGCTGGG - Intergenic
1131139732 15:89967453-89967475 TCTTGGCCTCCCACAGTGCTGGG - Intergenic
1131253209 15:90844423-90844445 TCTTGGCCTCCCAAAGAGCTGGG - Intergenic
1131583251 15:93665882-93665904 TCTTGGCCTCACAAAGTGCTGGG + Intergenic
1131705477 15:94990971-94990993 TCATTGCCTCCCAAAGTGCTGGG + Intergenic
1132131662 15:99286379-99286401 TCCTTGCCTCCCAAAGTGCTGGG + Intronic
1132224759 15:100131923-100131945 TCGCTGCCTCACACAAAGCAGGG - Intronic
1132441363 15:101868592-101868614 TCATTGCCAGTCACAGACCTTGG - Intergenic
1132521220 16:390358-390380 TCTTGGCCTCCCACAGTGCTGGG - Intergenic
1133554067 16:6887910-6887932 TCATGGCCTCCCAAAGTGCTGGG + Intronic
1133741483 16:8655059-8655081 CCAATGCCCCACACAGGGCTTGG - Intergenic
1133780152 16:8932313-8932335 TCTTTGCCTCCCAGAGTGCTAGG - Intronic
1133965714 16:10530256-10530278 TCAGAGCCTCACACAGTGCCTGG + Exonic
1134204884 16:12229026-12229048 TCATTCCTTCACACAGACCTTGG + Intronic
1134570896 16:15290209-15290231 TCTTGGCCTCCCAAAGAGCTGGG - Intergenic
1134731483 16:16465865-16465887 TCTTGGCCTCCCAAAGAGCTGGG + Intergenic
1135402423 16:22175207-22175229 TCTTGGCCTCACAAAGTGCTGGG - Intronic
1135569368 16:23536544-23536566 CCTTGGCCTCCCACAGAGCTGGG - Intronic
1136094294 16:27943823-27943845 TCTTTGCCTCCCAAAGTGCTAGG + Intronic
1136101005 16:27995947-27995969 TCTTGGCCTCCCACAGTGCTAGG - Intronic
1136191827 16:28621229-28621251 TCATGGCCTCCCAAAGTGCTGGG - Intronic
1136330593 16:29573661-29573683 TCTTTGCCTCCCAAAGTGCTGGG - Intergenic
1136508178 16:30719762-30719784 TCTTGGCCTCCCAGAGAGCTGGG + Intronic
1136532590 16:30879603-30879625 TCCTGGCCTCACAAAGTGCTGGG - Intronic
1137043130 16:35632016-35632038 CCTTTGCCTCTCACAGTGCTGGG + Intergenic
1137237104 16:46625375-46625397 TAACTGCCTCACCCTGAGCTGGG - Intergenic
1137245965 16:46705277-46705299 TCTTGGCCTCCCAAAGAGCTGGG - Intergenic
1137373317 16:47928983-47929005 TCATTTCCTCACACAAACCAAGG - Intergenic
1137378409 16:47975159-47975181 CCTTTGCCTCACAAAGTGCTGGG - Intergenic
1137775644 16:51052278-51052300 TCTTGGCCTCCCACAGTGCTGGG + Intergenic
1138861123 16:60758882-60758904 TCTTTTCCTCACACATTGCTAGG - Intergenic
1139163138 16:64535426-64535448 TCTTTGACTCACAAAAAGCTTGG - Intergenic
1139317842 16:66088592-66088614 TCAATGCCTCACACAGGGCATGG - Intergenic
1139438407 16:66949971-66949993 TCTCTGCCTCACACAGTGCTGGG - Intergenic
1140229437 16:73105499-73105521 TCTTTGCCTCCCAAAGTGCTGGG - Intergenic
1140520017 16:75572785-75572807 TCTTTGCCAGACTCAGAGCTTGG + Intronic
1140644185 16:77011777-77011799 TCTTTGCCTCCCAAAGTGCTGGG - Intergenic
1140873115 16:79124938-79124960 TCATTAACTCTCTCAGAGCTTGG - Intronic
1140945359 16:79763351-79763373 TCATTGCCTCAGTCAGCCCTTGG + Intergenic
1141077772 16:81023684-81023706 TCTTGGCCTCCCAAAGAGCTAGG - Intronic
1142108873 16:88320632-88320654 CCTTTGCCTCACAAAGTGCTGGG + Intergenic
1142359057 16:89617771-89617793 TCTTGGCCTCCCACAGCGCTGGG - Intronic
1142727281 17:1825049-1825071 TAATTGACTCACACATGGCTGGG - Intronic
1143687174 17:8526981-8527003 TCCATGCCTCACACAGTGCTGGG - Intronic
1143882170 17:10038105-10038127 TCTTGGCCTCCCACAGTGCTGGG - Intronic
1144534695 17:16077144-16077166 TCTTGGCCTCCCACAGTGCTGGG - Intronic
1144647571 17:16985938-16985960 TCATGGCCTCCCAAAGTGCTAGG - Intergenic
1145116266 17:20213343-20213365 TCAGTGCCTCCCAAAGTGCTGGG + Intronic
1145953209 17:28836389-28836411 TCATGGCCTCCCAAAGTGCTGGG - Intronic
1145955855 17:28854290-28854312 TCAAGGCCTCAAACAGAGCAAGG + Intronic
1146218609 17:30998992-30999014 TCCTTGGCTCAGACAGACCTGGG + Exonic
1146224624 17:31054797-31054819 TCATGGCCTCCCAAAGTGCTGGG + Intergenic
1146498721 17:33345974-33345996 CCTTGGCCTCACACAGTGCTGGG - Intronic
1147203168 17:38817536-38817558 TCTTTGCCTCCCAAAGTGCTGGG - Intronic
1147263711 17:39223184-39223206 TACCTGCCTCACACTGAGCTTGG + Intronic
1147518160 17:41141900-41141922 TCTTGGCCTCACACAAAGCAAGG + Intergenic
1148630455 17:49104237-49104259 CCTTGGCCTCACACAGTGCTGGG - Intergenic
1148969399 17:51466165-51466187 CCACTGCCTGCCACAGAGCTTGG + Intergenic
1149118668 17:53133215-53133237 TCACTGCTTCTAACAGAGCTGGG - Intergenic
1149513665 17:57263575-57263597 TCATTTGATCACTCAGAGCTTGG + Intronic
1149523581 17:57337073-57337095 TCATTGTCTCCTCCAGAGCTTGG + Intronic
1149676268 17:58465270-58465292 CCATGGCCTCCCAAAGAGCTGGG + Intronic
1149712109 17:58752819-58752841 TCACAGCCTCACAAAGTGCTGGG + Intergenic
1149789612 17:59465641-59465663 TCTTGGCCTCACAAAGTGCTAGG + Intergenic
1150342616 17:64380758-64380780 TCCTGGCCTCCCACAGTGCTGGG - Intronic
1150496075 17:65608750-65608772 TCTTGGCCTCACAAAGTGCTGGG - Intronic
1150686649 17:67326455-67326477 TCATAGCCTCCCAAAGTGCTGGG + Intergenic
1151231731 17:72689988-72690010 TGATCCCCTCACACAGCGCTCGG - Intronic
1151618122 17:75227889-75227911 TCTTGGCCTCCCACAGTGCTAGG + Intronic
1152169219 17:78732836-78732858 TCTTGGCCTCCCACAGTGCTGGG - Intronic
1152234015 17:79129190-79129212 TCAGTGCTTCACCCAGTGCTGGG - Intronic
1152999536 18:441744-441766 TCTTGGCCTCCCAGAGAGCTGGG - Intronic
1153273826 18:3349147-3349169 TCTTGGCCTCACAAAGTGCTGGG - Intergenic
1153413705 18:4822756-4822778 TCTTGGCCTCCCACAGTGCTGGG - Intergenic
1153559648 18:6359162-6359184 TCATAACCTCAAACACAGCTGGG + Intronic
1153807245 18:8719818-8719840 TCTTTGCCTCCCAAAGTGCTGGG + Intronic
1154292920 18:13126383-13126405 CCTTTGCCTCACAAAGTGCTGGG + Intergenic
1155872377 18:31043631-31043653 CCATGCCCTCACACAAAGCTTGG - Intergenic
1156094492 18:33512378-33512400 CCTTTGCCTCCCAGAGAGCTCGG + Intergenic
1156650349 18:39218564-39218586 TCAGTGCCTAACACAAAACTGGG + Intergenic
1157455311 18:47822938-47822960 TCTTGGCCTCCCAAAGAGCTGGG + Exonic
1158021917 18:52853236-52853258 TTAGTGCCTGGCACAGAGCTGGG + Intronic
1158124351 18:54084946-54084968 TCTTTGCCTCCCAAAGTGCTGGG - Intergenic
1158574921 18:58628822-58628844 TCAATGCCTCACACACAGCCTGG - Exonic
1158589440 18:58767602-58767624 TCTTGGCCTCTCACAGTGCTGGG - Intergenic
1158826097 18:61221534-61221556 TCATTGCCTAGCACAGTGCCTGG - Intergenic
1159588652 18:70307145-70307167 TCATGGCCTCCCAAATAGCTGGG - Intronic
1159594187 18:70367012-70367034 TCAGTGCTTAACACAGGGCTTGG - Intergenic
1159784706 18:72698939-72698961 TCATTGTCTCACAGACAACTGGG + Intergenic
1160643619 19:164877-164899 TCATTGCCAGTCACAGACCTTGG + Intergenic
1160737823 19:672398-672420 TCTTGGCCTCACAAAGTGCTGGG - Intergenic
1161234358 19:3190498-3190520 ACATTGCTGGACACAGAGCTGGG + Intronic
1161393996 19:4035136-4035158 GCATCGCCTCAGAGAGAGCTCGG + Intronic
1161419253 19:4167090-4167112 TCTTTGCCTCCCAAAGAGCTGGG - Intronic
1161653724 19:5500297-5500319 TCATGGCCTCCCACAGTGCTGGG - Intergenic
1161799797 19:6411216-6411238 TCTTGGCCTCCCACAGTGCTGGG - Intergenic
1162161679 19:8722750-8722772 TCTTGGCCTCACAAAGTGCTGGG - Intergenic
1162221580 19:9181700-9181722 TCACAGCCTCACAAAGTGCTGGG + Intergenic
1162379832 19:10324933-10324955 CCTTTGCCTCCCAAAGAGCTGGG - Intronic
1162454476 19:10775019-10775041 TCATGGCCTCCCAAAGTGCTGGG + Intronic
1162937392 19:13987964-13987986 TCTTTGGGTCAGACAGAGCTAGG - Intronic
1163096043 19:15057855-15057877 TCACTGTCTCACCTAGAGCTGGG - Exonic
1163209025 19:15826773-15826795 TCTTGGCCTCCCAAAGAGCTGGG + Intergenic
1163308627 19:16498532-16498554 TCCTGGCCTCCCACAGTGCTGGG + Intronic
1163608548 19:18289152-18289174 TCTCTGCCTCTCAAAGAGCTGGG - Intergenic
1163783687 19:19263436-19263458 TCTTGGCCTCACAAAGTGCTGGG - Intergenic
1164408036 19:27972095-27972117 TCGTGGCCTCCCACAGTGCTGGG - Intergenic
1164644774 19:29850430-29850452 TCACTGCCTCCCAAAGCGCTGGG + Intergenic
1164757108 19:30698039-30698061 CCATGGCCTCCCACAGTGCTGGG - Intronic
1164963621 19:32459703-32459725 TCATAGATTCACACAGAGCATGG - Intronic
1166182608 19:41119496-41119518 TCTTGGCCTCCCACAGTGCTGGG - Intronic
1166192213 19:41182599-41182621 CCATGGCCTCCCACAGTGCTGGG + Intergenic
1166561269 19:43733875-43733897 GCATTGCCCTACACAGAGCCTGG - Intronic
1166634361 19:44436528-44436550 TCTTGGCCTCACAAAGTGCTGGG - Intronic
1166744474 19:45134252-45134274 TCTTGGCCTCACATAGTGCTGGG + Intronic
1167305697 19:48707982-48708004 TCTTGGCCTCCCACAGTGCTGGG - Intergenic
1167626708 19:50594858-50594880 TCTTGGCCTCACAAAGTGCTGGG + Intergenic
1167904265 19:52645554-52645576 TCTTTGCCTCCCAGAGTGCTGGG - Intronic
1168033929 19:53703791-53703813 CCTTTGCCTCCCACAGTGCTGGG - Intergenic
1168612404 19:57811778-57811800 CCTTTGCCTCCCACAGTGCTGGG - Intronic
925659567 2:6187947-6187969 TCTTGGCCTCCCACAGTGCTGGG + Intergenic
926126345 2:10274501-10274523 TCTTGGCCTCCCACAGTGCTGGG + Intergenic
926142915 2:10379075-10379097 TCTTGGCCTCACAAAGTGCTGGG - Intronic
926195152 2:10759253-10759275 TCCTTGCCTCCAGCAGAGCTGGG + Intronic
926220787 2:10934377-10934399 ACATGGCCTCACACAGAGACAGG + Intergenic
926416372 2:12653580-12653602 TCATGGCCTCCCAAAGTGCTAGG - Intergenic
926784293 2:16505486-16505508 TCTATGCCTAACACAGTGCTTGG + Intergenic
926835146 2:17011059-17011081 TCAGTGCCTAACACAGGGCATGG + Intergenic
927493266 2:23534654-23534676 TCTGTGCCATACACAGAGCTGGG - Intronic
928268469 2:29832752-29832774 GCAGTGCCTCACTCAGAGCCTGG - Intronic
928535699 2:32239028-32239050 TCACTGCCTCCCATAGTGCTGGG - Intronic
929018686 2:37528083-37528105 TCTTGGCCTCCCACAGTGCTGGG + Intergenic
929458277 2:42082158-42082180 TCCTTGCCTCCCAAAGTGCTGGG + Intergenic
929738060 2:44572295-44572317 TCATGGCCTCCCAAAGTGCTGGG + Intronic
929790866 2:45022009-45022031 TGACAGCCTAACACAGAGCTGGG - Intergenic
930163745 2:48183431-48183453 TCAGTGCCTAAAACAGTGCTGGG + Intergenic
930197306 2:48522544-48522566 TCTTGGCCTCCCACAGTGCTGGG - Intergenic
930599594 2:53427875-53427897 TCTTTGCCTCCCAAAGTGCTGGG - Intergenic
930664555 2:54089339-54089361 TCTTGGCCTCACAAAGTGCTAGG - Intronic
931097821 2:58961924-58961946 TCTTGGCCTCCCACAGTGCTGGG + Intergenic
932565872 2:72908676-72908698 TCTTTGCCTCCCAAAGTGCTGGG - Intergenic
933440721 2:82310503-82310525 CCATGGCCTCACAAAGTGCTGGG - Intergenic
933500392 2:83103449-83103471 TCATGGCCTCCCAAAGTGCTGGG + Intergenic
933753879 2:85622068-85622090 TCTTGGCCTCCCACAGTGCTGGG + Intronic
933854888 2:86403574-86403596 CCATTACATCACTCAGAGCTGGG - Intergenic
934464964 2:94253621-94253643 CCATGGCCTCCCACAGCGCTGGG + Intergenic
934535841 2:95132617-95132639 TCTTTGCCTCCCAAAGTGCTGGG - Intronic
935217701 2:100987897-100987919 CCAGTGCCTGACACTGAGCTTGG + Intronic
935255211 2:101304144-101304166 TCTTGGCCTCCCACAGTGCTGGG - Intronic
936173650 2:110199180-110199202 TCATGGCCTCCCAAAGTGCTGGG - Intronic
936225327 2:110644232-110644254 TCATGGCCTCCCAAAGTGCTGGG - Intronic
936437579 2:112521679-112521701 CCATGGCCTCATACAGAGCCTGG - Intronic
936678164 2:114739406-114739428 TCTTGGCCTCCCACAGTGCTGGG - Intronic
937146319 2:119648118-119648140 TCAGTGCCTCACACATAGTAAGG + Intronic
937154507 2:119709569-119709591 TCTTGGCCTCCCAAAGAGCTAGG - Intergenic
937486911 2:122324768-122324790 CCATGGCCTCACAAAGTGCTGGG - Intergenic
938509345 2:131924502-131924524 TCTTGGCCTCCCAAAGAGCTGGG + Intergenic
938523021 2:132092152-132092174 CCATGGCCTCACAAAGAGCTAGG - Intergenic
939384164 2:141475121-141475143 GCGTTGCCTCCCACAGTGCTTGG - Intronic
940241193 2:151564812-151564834 TCATTGCCTCCTAAAGAGCCCGG + Intronic
940421602 2:153485650-153485672 TCTTTGCCTCCCAAAGTGCTAGG - Intergenic
940688197 2:156880729-156880751 TCTTGGCCTCACAAAGTGCTGGG + Intergenic
940818081 2:158318883-158318905 CCTTAGCCTCCCACAGAGCTGGG + Intronic
941129831 2:161633561-161633583 TCATTGCTTCTCACAAACCTGGG - Intronic
941677377 2:168357857-168357879 CCTTGGCCTCACACAGTGCTGGG + Intergenic
942468377 2:176232872-176232894 TCTTGGCCTCCCAAAGAGCTGGG - Intergenic
943074826 2:183180990-183181012 TCATTGCCTCAGATGGAGGTAGG - Intergenic
943341282 2:186685018-186685040 TTATAGCCTCACTCAGTGCTGGG - Intergenic
943678839 2:190746209-190746231 TCCTTGCCTCCCACAGTGCTAGG - Intergenic
943953421 2:194158237-194158259 GTATTGCATCACACAGAGCCTGG + Intergenic
944027196 2:195184695-195184717 TCTTGGCCTCACAAAGTGCTGGG + Intergenic
944213868 2:197234440-197234462 TCTCGGCCTCACACAGTGCTGGG + Intronic
945008115 2:205431325-205431347 TCTTTGCCTCCCAAAGTGCTGGG + Intronic
946269650 2:218580217-218580239 ACATGGCCTCCCACAGCGCTGGG + Intronic
946314824 2:218903997-218904019 TCAATGCCTAGCACAGTGCTTGG + Intergenic
946436313 2:219658192-219658214 TCCTTGCCTCACAGAGAGGGGGG + Intergenic
946802723 2:223437524-223437546 TCTTGGCCTCCCAAAGAGCTGGG - Intergenic
946815162 2:223569598-223569620 TCATTGCCTCACACTGATCTAGG - Intergenic
947127538 2:226886229-226886251 TCAGTGACTCAAACAGTGCTTGG + Intronic
1169463336 20:5815828-5815850 TCATGGCCTCCCAAAGTGCTGGG - Intronic
1169702825 20:8467189-8467211 TCTTGGCCTCACAAAGTGCTGGG + Intronic
1170414960 20:16129797-16129819 TCCTTGCCTCACACAGAGCTTGG + Intergenic
1170507164 20:17039112-17039134 CCAGTGCCTCCCAGAGAGCTTGG - Intergenic
1170839283 20:19910682-19910704 CCATAGCCTCCCACAGAGCTGGG + Intronic
1170939944 20:20840465-20840487 TCTTGGCCTCACAAAGTGCTGGG + Intergenic
1171504930 20:25625212-25625234 TCTTGGCCTCCCAAAGAGCTGGG + Intergenic
1172529730 20:35621609-35621631 GCTGTGCCTCACACAGAGTTGGG - Intergenic
1172616858 20:36294051-36294073 ACTTTGCCTCCCACAGTGCTGGG + Intergenic
1172710403 20:36918199-36918221 TCATGGCCTCCCAAAGTGCTGGG + Intronic
1172964492 20:38824776-38824798 TCTTTGCCTCACAAAGTGCTGGG - Intronic
1173223791 20:41149941-41149963 TCTTGGCCTCCCAAAGAGCTGGG - Intronic
1173676959 20:44844245-44844267 TCTTAGCCTCCCACAGTGCTGGG - Intergenic
1173976571 20:47191341-47191363 TCATTGCCCATCACAGAGCCTGG + Intergenic
1174044267 20:47722374-47722396 TCTTAGCCTCTCAAAGAGCTGGG + Intronic
1174387830 20:50197770-50197792 TCTTCTCCTCACACGGAGCTGGG - Intergenic
1174467456 20:50729248-50729270 ACACTCACTCACACAGAGCTGGG + Intergenic
1174802194 20:53573818-53573840 TCTTGGCCTCACAAAGCGCTGGG - Intronic
1175588986 20:60172144-60172166 TCATGGCCTGACATGGAGCTCGG + Intergenic
1176183359 20:63764184-63764206 TCTTGGCCTCACAAAGTGCTGGG - Intronic
1176444259 21:6805283-6805305 TCTTGGCCTCACAAAGTGCTGGG - Intergenic
1176676743 21:9785645-9785667 TCCTTGCCTCCCAAAGTGCTGGG + Intergenic
1176784139 21:13234058-13234080 TCTTGGCCTCCCAAAGAGCTGGG - Intergenic
1176822424 21:13670321-13670343 TCTTGGCCTCACAAAGTGCTGGG - Intergenic
1176872357 21:14093799-14093821 TCATGGCCTCCCAAAGTGCTGGG - Intergenic
1178558472 21:33615402-33615424 TCTTGGCCTCACAGAGTGCTAGG + Intronic
1178756016 21:35350436-35350458 TCATGGCGTCTCTCAGAGCTGGG + Intronic
1178867611 21:36342766-36342788 TCTCTGCCTCACAAAGTGCTGGG - Intronic
1178941715 21:36912163-36912185 TCATTGGCACACACATATCTGGG - Intronic
1179114996 21:38482791-38482813 TCTTAGCCTCCCACATAGCTAGG + Intronic
1180586117 22:16892748-16892770 CCATGGCCTCCCACAGCGCTGGG + Intergenic
1180832196 22:18912039-18912061 TCTCTGGGTCACACAGAGCTTGG - Exonic
1181067646 22:20314303-20314325 TCTCTGGGTCACACAGAGCTTGG + Exonic
1181569101 22:23757536-23757558 CCTTTGCCTCACAAAGTGCTGGG + Intergenic
1181978102 22:26746714-26746736 CCCTTGGCTCTCACAGAGCTTGG + Intergenic
1182744588 22:32595824-32595846 TCATGGCCTCCCACAGTGTTGGG - Intronic
1182827565 22:33278966-33278988 TCTTGGCCTCCCACAGTGCTGGG + Intronic
1183071212 22:35397762-35397784 TTTTTGCCTCCCACAGAGCCTGG + Intergenic
1183209387 22:36441546-36441568 CCACTGCCTCCCACAGGGCTGGG + Intergenic
1183822020 22:40353874-40353896 TCTTGGCCTCACAAAGTGCTGGG + Intronic
1184179380 22:42809751-42809773 TCTTGGCCTCCCACAGTGCTGGG - Intronic
1184374977 22:44106078-44106100 TCTTGGCCTCCCAAAGAGCTGGG + Intronic
1184750942 22:46486296-46486318 TCCTTGCCTCCCAAAGTGCTGGG - Intronic
1185262450 22:49875669-49875691 TCTTGGCCTCCCAAAGAGCTGGG + Intronic
1185414615 22:50703137-50703159 TCGATGCATCCCACAGAGCTTGG - Intergenic
1185419454 22:50727415-50727437 TCATTGCCACACACAGAGCCTGG - Intergenic
1203282281 22_KI270734v1_random:137344-137366 TCTCTGGGTCACACAGAGCTTGG - Intergenic
949170989 3:996484-996506 TCTTGGCTTCACACAGTGCTGGG + Intergenic
949721086 3:6990951-6990973 TCTTTGCCTCTCAAAGCGCTGGG - Intronic
949982508 3:9510685-9510707 TCTTGGCCTCACAGAGTGCTGGG - Intronic
950497711 3:13343939-13343961 TCACTGCTTCACACAGAGCTAGG - Intronic
950646461 3:14380102-14380124 TCTCTGCCTCTCACAGTGCTGGG + Intergenic
950691057 3:14658223-14658245 TCAGTGCCTAAAACAGTGCTTGG + Intronic
951249195 3:20374442-20374464 TCATTGCCTCTTTCAGGGCTTGG - Intergenic
952678323 3:36060384-36060406 TGACTGCCTAACACAGGGCTAGG + Intergenic
953287789 3:41629737-41629759 CCTTGGCCTCCCACAGAGCTGGG - Intronic
953307968 3:41847665-41847687 TCAATGACACAAACAGAGCTAGG + Intronic
954206313 3:49061600-49061622 CCTTGGCCTCCCACAGAGCTGGG - Intronic
955066963 3:55541975-55541997 TCATTGCTTTTCACAGCGCTTGG - Intronic
955087273 3:55715463-55715485 TCATTCCCACACACTGAACTTGG + Intronic
955549367 3:60067002-60067024 TCAGTGCCTATCACAGAGGTAGG + Intronic
955741476 3:62095549-62095571 TCAGTGCCTAGCACAGTGCTTGG - Intronic
956133823 3:66079499-66079521 TAATTGCCTGGCACAGAGCCTGG + Intergenic
956417276 3:69045807-69045829 TCTTGGCCTCCCACAGTGCTGGG - Intronic
957700609 3:83706168-83706190 TCATGGCCTCCCAGAGTGCTGGG - Intergenic
957913120 3:86648714-86648736 TCTTGGCCTCCCACAGTGCTGGG - Intergenic
957946160 3:87066254-87066276 CCTTTGCCTCCCACAGTGCTAGG - Intergenic
958022054 3:88009543-88009565 TCTTGGCCTCCCAAAGAGCTGGG - Intergenic
958047191 3:88299755-88299777 CCTTTGCCTCTCAAAGAGCTGGG + Intergenic
958967501 3:100575619-100575641 GCCTTGCCTCCCACAGTGCTGGG + Intronic
959536567 3:107493044-107493066 TCTTGGCCTCCCAAAGAGCTAGG - Intergenic
959812014 3:110630399-110630421 CCATGCCCTCACACAGGGCTGGG - Intergenic
960608418 3:119531912-119531934 TCTTGGCCTCCCACAGTGCTGGG + Intronic
960942895 3:122946052-122946074 CCTTTGCCGCACACAGAGCTCGG - Intronic
961166243 3:124765804-124765826 TCTTGGCCTCACAAAGTGCTAGG - Intronic
961167421 3:124773155-124773177 TCTTGGCCTCCCAAAGAGCTGGG + Intronic
961247047 3:125463956-125463978 TCATAGCCTCTCAAAGTGCTGGG - Intronic
961375792 3:126465011-126465033 TCCATGCCTCGCACAGAGTTTGG - Intronic
961402947 3:126659953-126659975 TCAGTGCTTCACACAGAGCTGGG + Intergenic
961750223 3:129090072-129090094 TAACTGCCTCACCCTGAGCTGGG - Exonic
961766503 3:129215692-129215714 TCTTGGCCTCCCAAAGAGCTCGG - Intergenic
961972583 3:130986101-130986123 TCACTGCCACCCAGAGAGCTGGG + Intronic
962248000 3:133813939-133813961 CCACTGCCTCACACAGATATAGG - Intronic
962590891 3:136889140-136889162 TCTCTGCCTCCCAAAGAGCTAGG + Intronic
962637401 3:137345275-137345297 TCAGTGCTTAGCACAGAGCTTGG - Intergenic
964640381 3:158903786-158903808 TGATTGCCTTAAAAAGAGCTAGG - Intergenic
964670161 3:159216214-159216236 TCAGTGCATCACACAGATGTAGG + Intronic
964834630 3:160924206-160924228 TCAGTTGCTCCCACAGAGCTTGG + Intronic
966448638 3:180032601-180032623 CCTTTGCCTCCCACAGTGCTAGG - Intronic
966601409 3:181778921-181778943 TCTTGGCCTCCCAAAGAGCTAGG + Intergenic
966626148 3:182019221-182019243 TCTTGGCCTCCCACAGTGCTGGG + Intergenic
966917098 3:184591015-184591037 TCTTTGTTTCATACAGAGCTGGG - Intronic
967010344 3:185427100-185427122 CCTTTGCCTCACAAAGTGCTGGG - Intronic
967748503 3:193086659-193086681 TCTTTGTCTCACTCAAAGCTAGG + Intergenic
967771222 3:193335407-193335429 TCATTGCCTAAAATAGTGCTGGG - Intronic
968151621 3:196341398-196341420 TCTGAGCCTCACACAGAGCTTGG + Intergenic
968638716 4:1698109-1698131 TCTCTGCCTCCCACAGTGCTGGG - Intronic
968940944 4:3637369-3637391 CCATTGCCTCACACTGTGCCTGG - Intergenic
969010065 4:4054632-4054654 CCTTGGCCTCACACAGTGCTGGG + Intergenic
969086572 4:4661079-4661101 TCATGGCCTCCCAAAGTGCTGGG + Intergenic
969744166 4:9056615-9056637 CCTTGGCCTCACACAGTGCTGGG - Intergenic
970181304 4:13398526-13398548 TCTTTGCCTCCCAAAGTGCTGGG - Intronic
970379181 4:15489444-15489466 TCACTACCTCACACAGTACTGGG + Intronic
970767815 4:19572200-19572222 TCATTGCTTCACAAAGAGTCAGG + Intergenic
970929189 4:21489206-21489228 TCATTGCCAAGCACAGTGCTAGG - Intronic
971374006 4:26041629-26041651 TCTTTGGTTCAGACAGAGCTGGG - Intergenic
972429302 4:38964972-38964994 CCTTTGCCTCTCACAGTGCTGGG + Intergenic
972482214 4:39507696-39507718 TCTTTGCCTCCCAAAGTGCTGGG - Intronic
972662082 4:41126127-41126149 TCTCTGCCTCCCACAGTGCTGGG - Intronic
972848996 4:43025349-43025371 CCATTGCCTTACACAGTGCCTGG + Intronic
972883270 4:43450486-43450508 TCATGGCCTCCCAAAGTGCTGGG + Intergenic
973796135 4:54428573-54428595 TCATGGCCTCCCAAAGTGCTGGG - Intergenic
973860721 4:55062170-55062192 TCTTTGCCTCCCAAAGTGCTGGG + Intergenic
973934295 4:55827526-55827548 TCAATTCCTAACACAGTGCTTGG + Intergenic
974388300 4:61231585-61231607 TCATTGCCTCCCCCGGATCTAGG + Intronic
974439553 4:61898865-61898887 TCATAGCCTCCCAAAGTGCTAGG + Intronic
974883004 4:67782531-67782553 TCTTGGCCTCCCACAGTGCTGGG + Intergenic
975556195 4:75667638-75667660 CCATTGCCTCCCAAAGTGCTGGG - Intronic
976222963 4:82772851-82772873 TCATTGCCTCTCATAGTGCCTGG + Intronic
978534646 4:109748300-109748322 TCAGTGCCTAACACAGTGCCTGG - Intronic
979055585 4:115989013-115989035 GCCTTGCCTCACAAAGTGCTGGG + Intergenic
979207250 4:118053592-118053614 CCATGTCCTCACACAGATCTGGG + Intronic
979522477 4:121684927-121684949 TCTTGGCCTCCCAAAGAGCTAGG - Intronic
981321780 4:143400191-143400213 TCATGGCCTCCCAAAGTGCTGGG + Intronic
982072149 4:151704995-151705017 CCATTGCCTCCCAAAGTGCTGGG + Intronic
982528600 4:156509584-156509606 CCTTTGCCTCACAAAGTGCTGGG - Intergenic
982778686 4:159467724-159467746 TCGTTGCCTCCCAAAGTGCTGGG + Intergenic
983319484 4:166177785-166177807 CCTTGGCCTCCCACAGAGCTGGG + Intergenic
983365174 4:166777524-166777546 ACCTTGCCTCACAAAGCGCTGGG - Intronic
983630439 4:169843994-169844016 TGATTGCCTCCCAAAGTGCTGGG + Intergenic
983764292 4:171458126-171458148 TCTTTGCCTCCCAAAGTGCTGGG - Intergenic
983914327 4:173275348-173275370 TCAGTTCCCCACTCAGAGCTCGG - Intronic
984107129 4:175561998-175562020 ACAGTGCCTCACAGAGAGTTGGG - Intergenic
984812885 4:183810469-183810491 TCATTGCCAAAGAAAGAGCTGGG + Intergenic
985237318 4:187890321-187890343 CCTTGGCCTCTCACAGAGCTGGG - Intergenic
985249889 4:188013285-188013307 TCTTGGCCTCCCAAAGAGCTGGG - Intergenic
985778106 5:1855745-1855767 GCGTTGCCTCACATCGAGCTGGG - Intergenic
986476798 5:8142765-8142787 TCTTGGCCTCCCAAAGAGCTGGG - Intergenic
987097676 5:14564609-14564631 TCTTTGCCTCTCAAAGTGCTGGG + Intergenic
987107067 5:14649967-14649989 TCTTGGCCTCTCAAAGAGCTAGG - Intergenic
987473403 5:18360529-18360551 CCTTTGCCTCCCAAAGAGCTGGG + Intergenic
987519932 5:18968727-18968749 TCTTGGCCTCACAAAGTGCTGGG + Intergenic
987613775 5:20245603-20245625 GCAGTGCCTGGCACAGAGCTTGG + Intronic
987628209 5:20431238-20431260 TCATGGCCTCCCAAAGTGCTGGG - Intronic
987743840 5:21945172-21945194 TCTTGGCCTCCCACAGTGCTGGG - Intronic
988033156 5:25792459-25792481 CCATTGCCTCCCAAAGTGCTGGG - Intergenic
988292435 5:29305710-29305732 TCTTGGCCTCCCAAAGAGCTGGG + Intergenic
988510169 5:31858074-31858096 TCTTGGCCTCCCACAGTGCTAGG + Intronic
989071120 5:37512833-37512855 TCTTGGCCTCCCAAAGAGCTGGG + Intronic
989199776 5:38751663-38751685 TCTTAGCCTCCCAAAGAGCTAGG + Intergenic
989372470 5:40723612-40723634 CCATGGCCTCCCACAGTGCTGGG - Intronic
989696658 5:44209476-44209498 CCATGGCCTCCCAAAGAGCTGGG + Intergenic
991764042 5:69955312-69955334 TCTTGGCCTCCCACAGTGCTGGG - Intergenic
991770224 5:70033908-70033930 TCTTGGCCTCCCATAGAGCTGGG + Intronic
991783283 5:70162823-70162845 TCTTGGCCTCCCACAGTGCTGGG + Intergenic
991843274 5:70830382-70830404 TCTTGGCCTCCCACAGTGCTGGG - Intergenic
991849519 5:70909327-70909349 TCTTGGCCTCCCATAGAGCTGGG + Intronic
991875727 5:71163159-71163181 TCTTGGCCTCCCACAGTGCTGGG + Intergenic
991935967 5:71800517-71800539 TCTTTGCCTCCCAAAGTGCTAGG - Intergenic
992555934 5:77903633-77903655 TCATAGCCTCCCAAAGTGCTGGG - Intergenic
992694777 5:79275409-79275431 TCTTGGCCTCCCACAGTGCTGGG + Intronic
993495713 5:88606389-88606411 TTCTTGCCTCATACATAGCTGGG - Intergenic
993571673 5:89548206-89548228 TCGCTGCCTCCCACAGTGCTGGG - Intergenic
995059622 5:107799244-107799266 TCTTGGCCTCCCAAAGAGCTAGG + Intergenic
995852936 5:116565360-116565382 TCAGTGCCTCACATAGTGTTGGG - Intronic
996655071 5:125925686-125925708 GTATTGCATCACACAGAGCCAGG - Intergenic
996913367 5:128680667-128680689 TCATTGCTTGACACAGATCCTGG - Intronic
997064436 5:130545151-130545173 GTATTGCATCACACAGAGCCTGG + Intergenic
997129340 5:131261600-131261622 TCCTCGCCTCACAAAGTGCTGGG - Intronic
997176923 5:131788416-131788438 TCTTGGCCTCCCACAGTGCTGGG - Intronic
997738391 5:136231853-136231875 TCTTAGCCTCCCACAGTGCTGGG + Intronic
997962929 5:138336431-138336453 TCTTGGCCTCACAAAGTGCTGGG - Intronic
998016383 5:138735454-138735476 TCTTGGCCTCCCACAGTGCTGGG + Intronic
998521522 5:142805350-142805372 TCTTTGCCTCCCAAAGTGCTGGG + Intronic
998593566 5:143503397-143503419 TCAGTGCCAAGCACAGAGCTGGG + Intergenic
999275104 5:150325013-150325035 CCAGTGCCTAACATAGAGCTGGG + Intronic
999387638 5:151166292-151166314 TGCTTGCCTCACAAAGTGCTGGG + Intergenic
999394969 5:151221533-151221555 TCATTGCCTTATACAGATCATGG - Intronic
1000131724 5:158306588-158306610 TCTTTGCCTCCCAAAGTGCTGGG + Intergenic
1000523402 5:162325861-162325883 TCTTTGTCTTACTCAGAGCTGGG - Intergenic
1000656983 5:163891080-163891102 TCACAGCCTCCCACATAGCTGGG + Intergenic
1001364063 5:171119787-171119809 TCTTGGCCTCCCACAGTGCTGGG - Intronic
1001624468 5:173118974-173118996 TCTTGGCCTCCCAAAGAGCTGGG + Intronic
1002497993 5:179628687-179628709 CCATGGCCTCCCAGAGAGCTAGG - Intronic
1002733304 5:181359914-181359936 TCATTGCCAGTCACAGACCTTGG - Intergenic
1002751236 6:114204-114226 TCATTGCCAGTCACAGACCTTGG + Intergenic
1003454240 6:6266460-6266482 TCTTGGCCTCCCAAAGAGCTGGG + Intronic
1003918151 6:10806741-10806763 TCCTGGCCTCCCACAGTGCTGGG + Intronic
1005478914 6:26236583-26236605 GCATGGCCTCACAAAGTGCTGGG - Intergenic
1006126843 6:31844420-31844442 CCATGGCCTCCCACAGTGCTGGG - Intergenic
1006310072 6:33251091-33251113 CCATGGCCTCCCACAGTGCTGGG - Intronic
1006797408 6:36740628-36740650 TCAATGCCTAGCACAGAGCGTGG + Intergenic
1006827345 6:36945644-36945666 TCTTAGCCTCCCAAAGAGCTGGG - Intergenic
1007275941 6:40673864-40673886 CCAGTGCCTTACACAGTGCTTGG - Intergenic
1007635168 6:43295492-43295514 CCTTTGCCTCACAAAGTGCTGGG + Intergenic
1007792951 6:44323621-44323643 TCTCTGCCTCACAAAGTGCTAGG - Intronic
1007877879 6:45127063-45127085 TCTTGGCCTCACAAAGTGCTGGG - Intronic
1008542408 6:52556675-52556697 TCTTAGCCTCCCAAAGAGCTGGG - Intronic
1008818232 6:55596072-55596094 TCTTGGCCTCCCAAAGAGCTGGG - Intergenic
1010458439 6:76085341-76085363 ACACTGCCTAACACAGAGTTGGG + Intergenic
1010742547 6:79525944-79525966 GTATTGCATCACACAGAGCCTGG - Intronic
1011469823 6:87697056-87697078 CCTTGGCCTCACACAGTGCTGGG - Intronic
1011830018 6:91360514-91360536 TCAATGCCTTACATAGTGCTTGG + Intergenic
1012072945 6:94646042-94646064 TCAGTGCTTAACACAGTGCTTGG - Intergenic
1013000735 6:106019888-106019910 TCATGGCCTCCCAAAGTGCTGGG + Intergenic
1013250586 6:108329188-108329210 TCTTGGCCTCACAAAGTGCTGGG + Intronic
1013684051 6:112558281-112558303 TCACTGTCTCTCCCAGAGCTGGG - Intergenic
1014767533 6:125423963-125423985 CCATTGCCTCACATACACCTCGG + Intergenic
1014998395 6:128182599-128182621 TCATTCCCTCTCACATAGATAGG + Intronic
1015459013 6:133466902-133466924 TCATAGCCTCCCACTGGGCTTGG - Intronic
1016341560 6:143066917-143066939 CCATGGCCTCCCACAGTGCTGGG - Intronic
1016459768 6:144270138-144270160 TCCTTGCCTCTCAAAGTGCTGGG + Intergenic
1016510724 6:144839985-144840007 CCATGGCCTCCCAAAGAGCTGGG - Intronic
1017986543 6:159447730-159447752 TCATTGCTCTGCACAGAGCTGGG + Intergenic
1019034915 6:169046607-169046629 AAATTGACTCACACAGTGCTGGG - Intergenic
1019237554 6:170632236-170632258 TCATTGCCAGTCACAGACCTTGG - Intergenic
1019662271 7:2231367-2231389 TCTTGGCCTCACAAAGTGCTGGG - Intronic
1019835318 7:3377690-3377712 TCACTGCCACACACAGGGCAGGG + Intronic
1021097493 7:16549966-16549988 TCATGGCCTCCCAAAGTGCTGGG - Intronic
1021161360 7:17277017-17277039 TCAGTGCCTGACACAGAGTCTGG - Intergenic
1021522408 7:21551048-21551070 GTATTGCATCACACAGAGCCTGG + Intronic
1021531398 7:21649913-21649935 GCATTGCCTCCCAAAGTGCTGGG + Intronic
1021783112 7:24125889-24125911 CCAATGCCTAGCACAGAGCTGGG - Intergenic
1022126799 7:27365534-27365556 TCATTTCCTTTCAAAGAGCTCGG + Intergenic
1022821835 7:33969807-33969829 ACTCTGCCTCACACAGAGCCTGG - Intronic
1022829772 7:34054214-34054236 TCATTGCTTAACATAGTGCTAGG + Intronic
1022893939 7:34730022-34730044 TCATGGCCTCCCAAAGTGCTGGG + Intronic
1023379241 7:39589507-39589529 CCTTGGCCTCTCACAGAGCTGGG + Intronic
1023430825 7:40089182-40089204 TCGTGGCCTCCCAAAGAGCTGGG - Intronic
1023667689 7:42541925-42541947 TCTTGGCCTCACAAAGAGCTGGG - Intergenic
1023739071 7:43261968-43261990 CCTTGGCTTCACACAGAGCTGGG - Intronic
1023754744 7:43406124-43406146 TCATTGTCTTGCACAGAGCAAGG + Intronic
1024534667 7:50420286-50420308 TCAGGGCCTCACACAGGGCTGGG + Intergenic
1025140503 7:56459636-56459658 TCTTTGCCTCCCAAAGTGCTGGG - Intergenic
1025240236 7:57265877-57265899 TCTTTGCCTCCCAAAGTGCTGGG - Intergenic
1025728776 7:64091682-64091704 TCTTTGCCTCTCAAAGTGCTAGG - Intronic
1025958081 7:66197923-66197945 TCTTGGCCTCCCACAGTGCTAGG + Intergenic
1026060826 7:67024415-67024437 TCTTGGCCTCACAGAGTGCTGGG + Intronic
1026254982 7:68703274-68703296 TCTTAGCCTCCCAAAGAGCTGGG + Intergenic
1026368662 7:69675755-69675777 TCTTGGCCTCCCACAGTGCTGGG + Intronic
1026729545 7:72899313-72899335 ACATTTCCTCACACATAGGTAGG + Intronic
1026736539 7:72952556-72952578 TCTTGGCCTCCCACAGTGCTGGG - Intergenic
1026919508 7:74144817-74144839 TCCTTGCCTCCCAAAGTGCTGGG + Intergenic
1027002890 7:74666586-74666608 TCATGGCCTCCCAAAGTGCTGGG - Intronic
1027107195 7:75412506-75412528 TCTTGGCCTCCCACAGTGCTGGG + Intergenic
1027251226 7:76400086-76400108 TCATTGCCTGACCCTGACCTTGG - Intronic
1027771759 7:82415962-82415984 TCTTGGCCTCCCAAAGAGCTGGG - Intronic
1028505180 7:91562585-91562607 AGATTCACTCACACAGAGCTGGG - Intergenic
1028761797 7:94505616-94505638 TCTTGGCCTCCCAAAGAGCTGGG + Intergenic
1029069166 7:97881190-97881212 CCTTGGCCTCACACAGTGCTGGG + Intergenic
1029299601 7:99569033-99569055 TCATGGCCTCCCAAAGTGCTGGG + Intronic
1030003095 7:105086472-105086494 CCATGGCCTCCCACAGTGCTGGG - Intronic
1030038584 7:105429784-105429806 CCTTGGCCTCACACAGTGCTGGG + Intergenic
1030556544 7:111032189-111032211 TCTTGGCCTCCCACAGTGCTGGG + Intronic
1032140554 7:129325953-129325975 TCTTGGCCTCACAAAGTGCTGGG + Intronic
1032142032 7:129340315-129340337 TCTTGGCCTCCCAAAGAGCTGGG - Intronic
1032790573 7:135239523-135239545 TCAGTGCGTAACACAGAGCCTGG - Intronic
1032798454 7:135298243-135298265 TCTTGGCCTCCCACAGTGCTAGG - Intergenic
1032817553 7:135492679-135492701 TCTTGGCCTCCCAAAGAGCTGGG - Intronic
1033090791 7:138384280-138384302 CCATGGCCTCACAAAGTGCTGGG - Intergenic
1034034950 7:147809342-147809364 TCAGTGCCAGACACAGTGCTGGG + Intronic
1034569509 7:151944051-151944073 TCCTAGCCTAACACAGGGCTCGG + Intergenic
1034993839 7:155565878-155565900 ACATTCCCTCCCACAGACCTGGG + Intergenic
1035510213 8:174375-174397 TCATTGCCAGTCACAGACCTTGG + Intergenic
1035678885 8:1473179-1473201 TCTTGGCCTCCCAAAGAGCTGGG + Intergenic
1035745504 8:1959818-1959840 TCAGGGCCTAAGACAGAGCTTGG - Intergenic
1035818958 8:2571054-2571076 CCTTGGCCTCACACAGTGCTGGG + Intergenic
1035839842 8:2799570-2799592 TCATTCCCTCCTACATAGCTGGG + Intergenic
1036234367 8:7025671-7025693 TGACTGCCTAACACATAGCTGGG - Intergenic
1036443195 8:8799503-8799525 TCTTTGCCTCGCAAAGTGCTGGG - Intronic
1036884873 8:12544582-12544604 CCTTGGCCTCACACAGTGCTGGG + Intergenic
1037686533 8:21144361-21144383 TCAGTGCCTAACCCAGTGCTTGG - Intergenic
1037754526 8:21702496-21702518 TCACTGCCCCACACACAGCCAGG + Intronic
1037958965 8:23082179-23082201 TCAGTGCCTCCCACAGAGGGAGG - Intergenic
1038281184 8:26166575-26166597 CCTTTGCCTCACAAAGTGCTGGG - Intergenic
1039176873 8:34818342-34818364 ACATTGCCTCAGAGAGAGCTTGG - Intergenic
1040633090 8:49239085-49239107 TCTTTGCCTCCCAAAGTGCTGGG - Intergenic
1040873199 8:52122091-52122113 TCCTTGCCTCCCAAAGTGCTGGG + Intronic
1041562641 8:59237361-59237383 CCAGTGTCTCACACAGTGCTAGG + Intergenic
1041680366 8:60582896-60582918 TCATGGCCTCCCAAAGTGCTGGG + Intronic
1042117543 8:65448600-65448622 TCACTGCCTCACATTGAGGTAGG - Intergenic
1042584332 8:70318513-70318535 TCCTTGCCTCCCAAAGTGCTGGG - Intronic
1042656449 8:71103111-71103133 ACATTTCCTAACACAGTGCTGGG - Intergenic
1042793034 8:72629757-72629779 TCAGTGCCTAGCACAGAGCCTGG - Intronic
1043089636 8:75881851-75881873 CCATGGCCTCCCACAGTGCTGGG + Intergenic
1043367213 8:79547274-79547296 TCTTGGCCTCCCACAGTGCTGGG - Intergenic
1043990246 8:86744231-86744253 TCTTTGCCTCACACAGGTTTGGG - Intergenic
1044543356 8:93431953-93431975 TCTTGGCCTCACAAAGTGCTGGG + Intergenic
1044657507 8:94564078-94564100 TCTTGGCCTCCCAAAGAGCTGGG - Intergenic
1044720300 8:95139251-95139273 TCTTGGCCTCACAAAGGGCTGGG - Intronic
1045351335 8:101343044-101343066 TAAGTGCCTCACACAGTGCCTGG - Intergenic
1045496455 8:102713475-102713497 TCTTGGCCTCACAAAGTGCTGGG - Intergenic
1045517518 8:102873329-102873351 TCTTGGCCTCCCACAGTGCTGGG - Intronic
1045520093 8:102895955-102895977 TCATGGCCTCCCAAAGTGCTGGG + Intronic
1045661104 8:104438830-104438852 CCATGGCCTCCCACAGAGCTGGG - Intronic
1046020363 8:108657605-108657627 CCTTTGCCTCACAAAGTGCTGGG - Intronic
1047828580 8:128606615-128606637 CCATTACCTAACACAGAGCTTGG - Intergenic
1047971230 8:130086384-130086406 TAAGTGCCTCACAGAGTGCTGGG - Intronic
1048130046 8:131685891-131685913 TCAGTGCCTAGCACAGAGCCTGG - Intergenic
1048174878 8:132142624-132142646 CCCTTACCCCACACAGAGCTTGG + Intronic
1048203867 8:132400275-132400297 ACATTACCTGACACAGAGCTGGG + Intronic
1048302152 8:133259733-133259755 CCATTGCCTCACCAAGAGCCCGG - Intronic
1048325732 8:133437424-133437446 TCAGTGCCTGACACAGTGCCTGG - Intergenic
1048918821 8:139209395-139209417 GCATAGCCCCAGACAGAGCTGGG - Intergenic
1049923417 9:386481-386503 TCATGCCCTCACACTGTGCTTGG + Intronic
1050164695 9:2752443-2752465 TCTTGGCCTCCCAAAGAGCTGGG - Intronic
1050318777 9:4429712-4429734 TCTGTGTCTGACACAGAGCTGGG - Intergenic
1050596076 9:7205848-7205870 ACATACCCTCACACAGAGCTGGG + Intergenic
1051978176 9:22980363-22980385 TCTTTGCCTCTCAAAGTGCTGGG - Intergenic
1052942430 9:34140400-34140422 TCTTGGCCTCCCACAGTGCTGGG - Intergenic
1053695043 9:40630350-40630372 CCATGGCCTCCCACAGCGCTGGG + Intergenic
1053701912 9:40702677-40702699 TCCTTGCCTCCCAAAGTGCTGGG + Intergenic
1053942028 9:43260736-43260758 CCATGGCCTCCCACAGCGCTGGG + Intergenic
1054269798 9:63009760-63009782 CCATGGCCTCCCACAGCGCTGGG - Intergenic
1054306287 9:63429575-63429597 CCATGGCCTCCCACAGCGCTGGG + Intergenic
1054405029 9:64753571-64753593 CCATGGCCTCCCACAGCGCTGGG + Intergenic
1054411974 9:64826132-64826154 TCCTTGCCTCCCAAAGTGCTGGG + Intergenic
1054438654 9:65239059-65239081 CCATGGCCTCCCACAGCGCTGGG + Intergenic
1054491750 9:65782887-65782909 CCATGGCCTCCCACAGCGCTGGG - Intergenic
1054892381 9:70265224-70265246 TCATGGCCTCCCAAAGTGCTGGG - Intronic
1055019091 9:71649784-71649806 TCTTTGCCTCCCAAAGTGCTGGG - Intergenic
1055786335 9:79872960-79872982 TCTTTTCCTGAGACAGAGCTGGG + Intergenic
1055900270 9:81226289-81226311 TCTTGGCCTCCCAAAGAGCTGGG - Intergenic
1056209421 9:84351406-84351428 TCTCTGCCTCACAAAGTGCTGGG - Intergenic
1056394753 9:86171365-86171387 TCAGTGCCTCAAAAAGGGCTGGG - Intergenic
1056473292 9:86926778-86926800 TCTTTGCCTCCCAAAGTGCTGGG + Intergenic
1056614963 9:88157301-88157323 CCCTTGCCTCCCAAAGAGCTGGG + Intergenic
1056792946 9:89637972-89637994 GGATTTCCACACACAGAGCTCGG - Intergenic
1056920742 9:90786423-90786445 TCTTGGCCTCCCACAGTGCTGGG - Intergenic
1057456641 9:95219082-95219104 TCATTGCCTGACTCAGAGTTCGG + Intronic
1057892820 9:98881972-98881994 CCATTGCCTCACATAGTGCCTGG + Intergenic
1058022522 9:100103799-100103821 TCTTGGCCTCACAAAGTGCTGGG + Intronic
1058296604 9:103315561-103315583 TCTTGGCCTCCCACAGTGCTGGG + Intergenic
1058677167 9:107410183-107410205 GGACTGCCTCACACAGAGCCAGG - Intergenic
1059172572 9:112139973-112139995 TCTCTGCCTCCCACAGTGCTGGG - Intronic
1059516500 9:114900729-114900751 CCATGGCCTCTCAAAGAGCTAGG - Intronic
1059631858 9:116133506-116133528 TGATTGCTTCACAGGGAGCTTGG + Intergenic
1059933494 9:119284400-119284422 TCTTTGCCAAACACAGAGCTAGG - Intronic
1060063081 9:120478519-120478541 CCTTGGCCTCCCACAGAGCTGGG - Intronic
1060099941 9:120831132-120831154 CCCTTGCCTCCCATAGAGCTGGG + Intronic
1060586793 9:124791484-124791506 TCTTGGCCTCCCAAAGAGCTGGG - Intronic
1061102057 9:128499543-128499565 TCATGGCCTCCCAAAGTGCTGGG + Intronic
1061299292 9:129695546-129695568 TCTTAGCCTGGCACAGAGCTGGG + Intronic
1062013719 9:134280729-134280751 ACGGGGCCTCACACAGAGCTGGG + Intergenic
1062185430 9:135215841-135215863 CCCTTGCATCACAGAGAGCTTGG - Intergenic
1062277316 9:135737048-135737070 CCAGTGCCTGGCACAGAGCTGGG - Intronic
1062757708 9:138312226-138312248 TCATTGCCAGTCACAGACCTTGG - Intergenic
1202777488 9_KI270717v1_random:3965-3987 CCATGGCCTCCCACAGCGCTGGG + Intergenic
1203524940 Un_GL000213v1:79244-79266 TCTTGGCCTCACAAAGTGCTGGG + Intergenic
1185600234 X:1334155-1334177 CCTTGGCCTCCCACAGAGCTGGG + Intergenic
1185683339 X:1906977-1906999 TCTTGGCCTCCCACAGTGCTGGG - Intergenic
1186265960 X:7834079-7834101 TCATTGCTTCACAGAGGACTGGG + Intergenic
1187049689 X:15683603-15683625 TCATGGCCTCCCAAAGGGCTGGG - Intergenic
1187208905 X:17209650-17209672 TCTTGGCCTCACATAGTGCTGGG + Intergenic
1188049316 X:25465306-25465328 TGTTTGCCTGACTCAGAGCTCGG - Intergenic
1188600445 X:31957078-31957100 TCTTAGCCTCCCACAGTGCTGGG - Intronic
1189490508 X:41467907-41467929 CCATAGCCTCACAAAGTGCTGGG + Intronic
1189543801 X:42020880-42020902 CCTTGGCCTCACACAGTGCTGGG + Intergenic
1190192730 X:48291164-48291186 TCTTGGCCTCCCACAGTGCTGGG + Intergenic
1190338778 X:49279982-49280004 TCAGGGCCTGACACACAGCTGGG - Intronic
1190649880 X:52558368-52558390 TCATGGCATCACACAGAGCAAGG + Intergenic
1190724239 X:53176996-53177018 TCTTGGCCTCACAAAGTGCTGGG - Intergenic
1190945263 X:55086643-55086665 TCTTGGCCTCACAAAGTGCTGGG + Intergenic
1191780270 X:64856913-64856935 TCAGCGCCTCACACAGAGCTTGG + Intergenic
1192198975 X:69051897-69051919 TCATGGCCTAACACAGGGCCTGG - Intergenic
1192262976 X:69519343-69519365 TCAGGGCCTCACATGGAGCTGGG - Intronic
1192493643 X:71598385-71598407 TCATTCCCACACATAGAGCGGGG - Intronic
1192579425 X:72268624-72268646 TCTTGGCCTCCCAAAGAGCTGGG + Intronic
1193588286 X:83355125-83355147 CCATGGCCTCCCACAGTGCTGGG + Intergenic
1194167516 X:90537512-90537534 TCTTTGCCTCTCAAAGTGCTGGG + Intergenic
1194198740 X:90929367-90929389 TCTTTGCCTCCCAAAGTGCTGGG + Intergenic
1194429388 X:93782313-93782335 ACTTTGCATCACTCAGAGCTCGG - Intergenic
1195049754 X:101086369-101086391 TCTTGGCCTCCCACAGTGCTGGG + Intronic
1196046955 X:111266471-111266493 TCATTGCCTAGCATTGAGCTGGG + Intronic
1196263154 X:113609347-113609369 TCTTTGCCTCCCAAAGTGCTGGG - Intergenic
1196401937 X:115325828-115325850 TCTTGGCCTCCCACAGTGCTGGG - Intergenic
1197207988 X:123806349-123806371 TCTTGGCCTCACAAAGTGCTGGG - Intergenic
1197720285 X:129740374-129740396 CCATGGCCTCCCAAAGAGCTGGG - Intronic
1198186970 X:134262842-134262864 ATATTGCCTAACACAGAGCTTGG + Intergenic
1198209456 X:134503310-134503332 CCATGGCCTCCCACAGTGCTGGG + Intronic
1199235061 X:145482639-145482661 CTATTGCCTCACACAATGCTTGG + Intergenic
1199758870 X:150890226-150890248 TCATGGCCTCACAAAGTGCTGGG - Intronic
1199899576 X:152159820-152159842 TCCTTGTCTAACACAGAACTTGG + Intergenic
1200086366 X:153609098-153609120 TCATGGCCTCTCAAAGTGCTGGG + Intergenic
1200407435 Y:2827622-2827644 CCATTGCCTCCCAAAGTGCTGGG + Intergenic
1200513773 Y:4115293-4115315 TCTTTGCCTCTCAAAGTGCTGGG + Intergenic
1200544737 Y:4505809-4505831 TCTTTGCCTCCCAAAGTGCTGGG + Intergenic
1200567296 Y:4782817-4782839 TCTTTGCCTCCCAAAGTGCTGGG - Intergenic
1200770889 Y:7124440-7124462 TCTTGGCCTCTCACAGTGCTGGG + Intergenic
1200792450 Y:7311947-7311969 TCTGTGCCTCCCACAGTGCTGGG + Intergenic
1201944768 Y:19499871-19499893 TCTTGGCCTCCCAAAGAGCTGGG + Intergenic
1202348059 Y:23955997-23956019 TCTTGGCCTCCCAAAGAGCTGGG + Intergenic
1202522715 Y:25714107-25714129 TCTTGGCCTCCCAAAGAGCTGGG - Intergenic