ID: 1090973614

View in Genome Browser
Species Human (GRCh38)
Location 11:131663496-131663518
Sequence GTCTGTCTGCAGCACGGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 147}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090973610_1090973614 -10 Left 1090973610 11:131663483-131663505 CCTTGACCGCTCTGTCTGTCTGC 0: 1
1: 0
2: 1
3: 24
4: 167
Right 1090973614 11:131663496-131663518 GTCTGTCTGCAGCACGGGCCAGG 0: 1
1: 0
2: 1
3: 21
4: 147
1090973605_1090973614 19 Left 1090973605 11:131663454-131663476 CCTCTCTCTGCCTCTGGTCCTGA 0: 1
1: 0
2: 3
3: 62
4: 573
Right 1090973614 11:131663496-131663518 GTCTGTCTGCAGCACGGGCCAGG 0: 1
1: 0
2: 1
3: 21
4: 147
1090973604_1090973614 24 Left 1090973604 11:131663449-131663471 CCATTCCTCTCTCTGCCTCTGGT 0: 1
1: 0
2: 11
3: 179
4: 1523
Right 1090973614 11:131663496-131663518 GTCTGTCTGCAGCACGGGCCAGG 0: 1
1: 0
2: 1
3: 21
4: 147
1090973608_1090973614 1 Left 1090973608 11:131663472-131663494 CCTGAGGCCTTCCTTGACCGCTC 0: 1
1: 0
2: 1
3: 32
4: 168
Right 1090973614 11:131663496-131663518 GTCTGTCTGCAGCACGGGCCAGG 0: 1
1: 0
2: 1
3: 21
4: 147
1090973607_1090973614 9 Left 1090973607 11:131663464-131663486 CCTCTGGTCCTGAGGCCTTCCTT 0: 1
1: 1
2: 4
3: 38
4: 308
Right 1090973614 11:131663496-131663518 GTCTGTCTGCAGCACGGGCCAGG 0: 1
1: 0
2: 1
3: 21
4: 147
1090973609_1090973614 -6 Left 1090973609 11:131663479-131663501 CCTTCCTTGACCGCTCTGTCTGT 0: 1
1: 0
2: 2
3: 20
4: 240
Right 1090973614 11:131663496-131663518 GTCTGTCTGCAGCACGGGCCAGG 0: 1
1: 0
2: 1
3: 21
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090973614 Original CRISPR GTCTGTCTGCAGCACGGGCC AGG Intronic
900194981 1:1371511-1371533 GTGGGTCTGCAGGAGGGGCCTGG + Intergenic
900300218 1:1973376-1973398 TTGTGTCTGCAGCCAGGGCCTGG + Intronic
904564555 1:31420636-31420658 ATCTGTGTGCACCAAGGGCCAGG - Intronic
905862789 1:41362007-41362029 GTCAGGCTGCGGCAGGGGCCAGG - Exonic
905872866 1:41415076-41415098 CTCAGGCTGCAGCACCGGCCAGG - Intergenic
907408977 1:54271639-54271661 GTCTGTATGCAGCACAGGCATGG - Intronic
910190109 1:84586260-84586282 CTCTGTCAGCAGCATGAGCCAGG + Intergenic
914196962 1:145452551-145452573 GCCTTTCTGCAGCACGGCCCTGG - Intergenic
915604647 1:156942827-156942849 GTGTGACTGCAGCCTGGGCCAGG + Intronic
921707831 1:218344917-218344939 GTATGTCTTCAGTACTGGCCTGG + Intergenic
1063095241 10:2903258-2903280 GTCTGGCTGCAGGACTGTCCGGG - Intergenic
1064517993 10:16170785-16170807 GGCTGACTGCAGCATGGGTCGGG + Intergenic
1069879242 10:71581398-71581420 GTCTGTCTGCCCCACGTGGCTGG + Intronic
1074712338 10:116187876-116187898 CTCTGTCTCCAGCCCTGGCCAGG - Intronic
1075213123 10:120508635-120508657 TTCTGGGTGCAGCACTGGCCAGG + Intronic
1075481968 10:122789734-122789756 CTCTGTCCCCAGCAGGGGCCTGG + Intergenic
1075550969 10:123391953-123391975 GTCTGGCAGCACCACGGGACTGG + Intergenic
1076189950 10:128475861-128475883 TCCTGTCTGCGGCGCGGGCCAGG - Intergenic
1076584185 10:131533934-131533956 TTCTGTCTGCAGCCCCTGCCAGG - Intergenic
1077168201 11:1153148-1153170 GTGGGGCTGCAGCAGGGGCCTGG - Intergenic
1077310742 11:1888043-1888065 CTCTGTCTGCAGCATGGGATGGG - Intronic
1077410062 11:2399797-2399819 GCCTGTCCGCAGCAGGGGGCAGG - Intergenic
1077888800 11:6404551-6404573 ATCTGTGTGCAGCAAGGGTCAGG - Intronic
1079594427 11:22224649-22224671 GTCTGTCTGCACCAATGTCCTGG - Intronic
1081625797 11:44654368-44654390 GGCTGTCTGTGGCACGGTCCAGG + Intergenic
1084665870 11:70575917-70575939 GCCAGGCTGCAGCACGGCCCAGG - Intronic
1084946352 11:72641028-72641050 GTCTGTGTGTAGCACGGGCTGGG - Intronic
1089694386 11:120208061-120208083 GTCTGTTCCCAGCACGGGGCTGG + Intergenic
1090829275 11:130409715-130409737 GTCTGGCAGCAGCACGTGGCAGG - Intronic
1090973614 11:131663496-131663518 GTCTGTCTGCAGCACGGGCCAGG + Intronic
1097189677 12:57213469-57213491 GCCTGCCTCCAGCACGGGGCAGG - Intergenic
1099543690 12:83949039-83949061 GTGTGTCTGGATCACTGGCCAGG - Intergenic
1102865604 12:116371588-116371610 CTTTGTCTGCAGCACAGGACAGG + Intergenic
1102955007 12:117053441-117053463 GTCTGTCTGCCTCACGATCCTGG - Intronic
1106928985 13:34643391-34643413 GTCTGTCAGCACCACTGGTCTGG + Intergenic
1107424935 13:40283404-40283426 GACTATTTGCAGCACAGGCCTGG + Intergenic
1107707867 13:43124791-43124813 CCCTGCCTGCAGCACAGGCCTGG + Intergenic
1108519529 13:51233954-51233976 GTCTGTGTCCAGCAGGGTCCTGG + Intronic
1114648298 14:24267842-24267864 TTCTGTCTGCAGAACAGACCAGG - Intronic
1115662029 14:35505871-35505893 GTGTGTCTTCAGCATGGCCCTGG + Intergenic
1118321171 14:64754166-64754188 GTCTGGCTGCAGCAAGGGGAGGG - Intronic
1119187160 14:72651154-72651176 GTCTTTCTGCAGCATGGCCCTGG + Intronic
1119644789 14:76340320-76340342 GTGTGTCAGGAGCATGGGCCGGG - Intronic
1119800783 14:77443335-77443357 GTCTCTCAGCAGCATGGGCACGG - Intronic
1121245228 14:92457237-92457259 CTGTGGCTGCAGCAGGGGCCAGG - Intronic
1122400500 14:101464682-101464704 GTGTGGCTGCAGCAAGGGGCTGG + Intergenic
1122713352 14:103677201-103677223 GGCTGTCTACAGGACGGGCCAGG + Intronic
1122884742 14:104706016-104706038 GTCTCTGTGCAGGAGGGGCCAGG - Exonic
1122891841 14:104735643-104735665 GTCCCTCTGCAGCACGGACTGGG - Intronic
1123877823 15:24641940-24641962 GTGTGTCTGTAGCACAGGCTAGG + Intergenic
1123895871 15:24829408-24829430 GTGTGTCTGTGGCACAGGCCAGG + Intronic
1125728042 15:41878081-41878103 GGCTCTCTGCAGCCCAGGCCCGG - Intronic
1127379779 15:58420765-58420787 GTCTGTGAGCAGCATGTGCCCGG - Intronic
1128319869 15:66685604-66685626 GTCTGTCTGCAGCTCTGGAGGGG - Exonic
1131157216 15:90082535-90082557 GCCTGTCACCAGCACGGGGCTGG - Intergenic
1132667458 16:1088778-1088800 GTCGGGCTGCAGCAGGGGTCAGG - Intergenic
1132760722 16:1507393-1507415 GTCTGCCTGCACCCCTGGCCTGG - Intronic
1132987423 16:2775004-2775026 GTCTGACTCCAGCAAGGGCCCGG + Intronic
1134689034 16:16178905-16178927 TTCTGTATACAGCCCGGGCCAGG + Exonic
1139446347 16:67000950-67000972 GTGTTTCTGCAGCACAGGCTCGG + Exonic
1143110054 17:4548079-4548101 GTCTGACTGGTGCAGGGGCCTGG - Intronic
1143518843 17:7434247-7434269 GTCTGTCTCCAGGACGGGATAGG - Intergenic
1145037006 17:19548191-19548213 GTCTGGGTGCAGCCAGGGCCAGG + Intronic
1146697085 17:34917654-34917676 GTCTGTTTGCTGCCTGGGCCAGG - Intergenic
1147455652 17:40536608-40536630 GTCTCTCTGCAGCATAGTCCAGG + Intergenic
1150491135 17:65575089-65575111 GTCTGCATGCAGCCCGGGCGAGG + Intronic
1150639399 17:66939387-66939409 GCCTGTCACCAGCAAGGGCCAGG - Intergenic
1160420377 18:78739970-78739992 GCCTGTCTGCAGCACCCTCCCGG + Intergenic
1160903857 19:1442923-1442945 GTCTCTGGGCAGCACTGGCCAGG + Intergenic
1161727061 19:5935715-5935737 GTCTGTCTGCAGCTCTGGAGAGG - Intronic
1163222785 19:15934184-15934206 GTTTGTCAGCAGGACGGGTCTGG - Intronic
1163764582 19:19155727-19155749 GTCTGTCTGCGGCTCTGGGCAGG - Intronic
1164650195 19:29885860-29885882 GTGTGCCTGCAACACAGGCCAGG - Intergenic
1165130589 19:33629504-33629526 GGCTGTCTGCAGCACAGGTCGGG + Intronic
1166056387 19:40291979-40292001 GTGTGTCTGGAACATGGGCCAGG - Intergenic
1166306885 19:41940341-41940363 GCCTGTCGGCCGCGCGGGCCGGG + Intergenic
1166519961 19:43473735-43473757 GTCTGTCTCCCGCTCTGGCCTGG - Intergenic
1168116443 19:54223465-54223487 GTCTGCCTGCAGCATGGACCTGG - Intronic
1168119425 19:54243240-54243262 GTCTGCCTGCAGCATGGACCTGG - Intronic
1168125644 19:54281005-54281027 GTCTGCCTGCAGCATGGACCTGG - Exonic
1168168833 19:54573369-54573391 GTCTAACTGCAGCATGGACCTGG + Exonic
1168176327 19:54630567-54630589 GTCTGCCTGCAGCATGGACCTGG + Exonic
1168185160 19:54695925-54695947 GTCTGCCTGCAGCATGGACCTGG + Intronic
1168645567 19:58056937-58056959 GTCTCACTGCAGCTCGGGCAGGG - Intergenic
926739606 2:16100435-16100457 CTCTGTCTTCAGCACAGGCCTGG + Intergenic
928943743 2:36753632-36753654 CTTTGTCAGCAGCACAGGCCTGG + Intronic
930700717 2:54456408-54456430 GTCTGTCCGCGGCTGGGGCCGGG - Exonic
931098674 2:58971299-58971321 GTCTGCCTGCAGCACACGTCAGG + Intergenic
932480667 2:72037168-72037190 GTCCATCTGCAGCCAGGGCCAGG + Intergenic
945961399 2:216139029-216139051 GTCTGTCTGCATCACGGTGGAGG + Intronic
948398390 2:237664066-237664088 GTCTCTCTGCAGCATGGACATGG - Intronic
1169060478 20:2657219-2657241 GTCAGTAGGCAGCACGGCCCTGG + Intronic
1178787064 21:35663620-35663642 GTCTGTCTGCTACAGGTGCCAGG + Intronic
1179457454 21:41508722-41508744 GTCTCTCGGCACCACCGGCCAGG + Intronic
1182623713 22:31631171-31631193 GCCTGTCTGCAGCCCGTGGCTGG + Intronic
1184242878 22:43220683-43220705 TTCCGTCTGCACCACGGACCAGG - Intronic
1184331810 22:43832479-43832501 GCCTGTGGTCAGCACGGGCCAGG - Intronic
1184405986 22:44301084-44301106 GTTTGTCGGGAGCAGGGGCCGGG + Intronic
1184679746 22:46063980-46064002 TTCTGTCTGCTGCACGGGCCAGG + Intronic
949542081 3:5040607-5040629 GTCTGTCTGCAGCACAACCAGGG - Intergenic
951049175 3:18075213-18075235 GGATGTCTGGAGCAAGGGCCTGG + Intronic
951049591 3:18079133-18079155 GGATGTCTGGAGCAAGGGCCTGG + Intronic
951518611 3:23589574-23589596 GTCTGTCAGCAGCAGGTGACTGG + Intronic
951792155 3:26497923-26497945 ATATGTCTGCAGCAAGGGTCAGG + Intergenic
954360042 3:50117082-50117104 GTCTTTCTGCAGCTCGGTCTCGG - Exonic
954926915 3:54243998-54244020 GTCTGTTTCCAGCACAGGACGGG - Intronic
959078796 3:101779131-101779153 GACTGACAGCAGCACGCGCCGGG - Intergenic
962207539 3:133447342-133447364 TTCTGTCTGCAGCATGAGCCGGG - Exonic
962834927 3:139181421-139181443 GTCTGTCTGCAGGCCTGGACTGG + Intronic
963786152 3:149536505-149536527 GGCTGTGAGCAGCACTGGCCTGG - Intronic
967136991 3:186520955-186520977 GTCTGACTGGAGCAAGGGACTGG - Intergenic
967844486 3:194033026-194033048 GTCAGTCTGCAGCCCGGGGTTGG - Intergenic
969265799 4:6063479-6063501 GTGTGCCTCCAGCACTGGCCTGG + Intronic
971550931 4:27954616-27954638 GTCTGTGTGCAACTAGGGCCGGG - Intergenic
976026703 4:80696418-80696440 GTCTTTCTGCAGCATGGGAGAGG + Intronic
980869910 4:138599035-138599057 GTCTGTCTGAAGCCCTGGCATGG - Intergenic
985416789 4:189743043-189743065 GACATTCTGCAGCACCGGCCTGG + Intergenic
986519088 5:8594601-8594623 GTTAGTTTGCAGCACAGGCCAGG + Intergenic
996710311 5:126536870-126536892 GTCTGCCAGCTGCAAGGGCCTGG + Intergenic
999538631 5:152547517-152547539 TTCTGTCTGCAGCACCCGCCTGG + Intergenic
1000296003 5:159914174-159914196 GTCTGTCTGCAGATAGGACCTGG - Intergenic
1001546800 5:172575325-172575347 GTCTGGCTGGAGGACAGGCCCGG - Intergenic
1001762519 5:174220132-174220154 GTAGGTCAGCAGCACTGGCCAGG + Intronic
1002363198 5:178689797-178689819 ATCTGTCTTCTGCACAGGCCAGG - Intergenic
1003508485 6:6759584-6759606 GTCTGACCCCCGCACGGGCCAGG + Intergenic
1003893453 6:10584415-10584437 GTCTGTCTCCCGCACGTCCCTGG - Intronic
1003940282 6:11017707-11017729 GAATGACTGCAGCACAGGCCAGG - Intronic
1004110692 6:12715864-12715886 AACTGTCTGCAGCACCGGCTTGG + Intergenic
1004128684 6:12898686-12898708 TTCTGCCTGCAGCACGAGACTGG - Intronic
1004162219 6:13224636-13224658 GTCTGTCAGCAGCAGGGCACAGG + Intronic
1005070347 6:21856583-21856605 GTGTGTATGCAACACGGGTCTGG - Intergenic
1005085208 6:21999307-21999329 GTATGTCTGCAGCACTGGTAGGG + Intergenic
1013667345 6:112362265-112362287 GTCTGTCTGCAGAACGATGCGGG + Intergenic
1016423884 6:143913561-143913583 GTCTTTCTGCAACACAGGCAAGG - Intronic
1018651489 6:165995174-165995196 ATCTGTCTGCTGCAAGGGCCAGG - Intergenic
1019075806 6:169387381-169387403 GTCTGGCTGCTGCATGAGCCTGG - Intergenic
1019312512 7:369617-369639 GCCCGTCTGCAGCGCGGGGCCGG - Intergenic
1019322194 7:420842-420864 GTCCGTCTGCCTCAGGGGCCTGG - Intergenic
1019626822 7:2020123-2020145 CTCTGTTTGCAGCACCAGCCGGG - Intronic
1024088576 7:45917365-45917387 GTCCGTCTCCAGCACGCACCGGG - Exonic
1025715259 7:63950124-63950146 CTTTGTCTGCAGCCTGGGCCAGG + Intergenic
1025850417 7:65239451-65239473 GTCTGTGGACACCACGGGCCAGG + Intergenic
1026882961 7:73919277-73919299 GTGTGTCTCCAGCATGGGGCTGG - Intergenic
1032128159 7:129209488-129209510 TGCTGTCTGCAGCAGGGACCTGG - Intronic
1035276677 7:157752153-157752175 CTGTGTCTGCAGCTCTGGCCTGG + Intronic
1035287666 7:157816594-157816616 GCCTGTCTCCAGGAGGGGCCCGG + Intronic
1035373487 7:158393544-158393566 GCCGGTCTGCAGCAGGTGCCGGG - Intronic
1035397580 7:158545328-158545350 GTCGGTCTGCAGCACAGGACTGG - Intronic
1035934986 8:3826643-3826665 GTTTATCTGCAGCTCGGGCATGG + Intronic
1038416030 8:27396803-27396825 GGCTGTCTGCAGAACTGGGCTGG + Intronic
1039904238 8:41774508-41774530 TTTTTTCTGCAGCACGGCCCTGG - Intronic
1041167068 8:55101690-55101712 GTGTGGCGGCAGCAAGGGCCAGG - Intergenic
1049210597 8:141384826-141384848 GTCTGTCTTCTCCACTGGCCTGG - Intergenic
1049446640 8:142634442-142634464 GTCTCACTGGAGCAGGGGCCTGG - Intergenic
1049680264 8:143915016-143915038 GTCTGTGTGCAGCAGAGACCAGG - Intergenic
1057428602 9:94974652-94974674 GGCTGTCTTCAGCAGGAGCCAGG + Intronic
1057576437 9:96246366-96246388 GTCTGTCTGCAGAGCTGGCCTGG + Intronic
1058227982 9:102390636-102390658 CTCTTTCTGCAGCAAGGGCAGGG - Intergenic
1058759363 9:108115884-108115906 GTCTGTTTACAGTAAGGGCCAGG + Intergenic
1058894616 9:109388538-109388560 GGCTGTCAGCAGCACGGAGCTGG + Intronic
1060992816 9:127858355-127858377 GACTGTCTCCAGCACTGGCCTGG + Intergenic
1061993532 9:134172926-134172948 CTGTCTCTGCAGCACAGGCCGGG - Intergenic
1062329629 9:136032599-136032621 GTCTGTATCCAGAACAGGCCAGG + Intronic
1062618127 9:137407263-137407285 CTCTGCCTGCAGCGCTGGCCTGG - Intronic
1062697772 9:137884291-137884313 GCCTTTCTGCAGCACGGCCCTGG + Intronic
1190094444 X:47467427-47467449 GTCCCTCTGCAGCCAGGGCCGGG + Exonic
1190448617 X:50555923-50555945 GACTGTCTGCAGGAGGGGCCAGG + Intergenic
1192048393 X:67700457-67700479 TTCTGTCTGCAGCAGAGACCAGG - Intronic
1196779015 X:119365719-119365741 GTTTGTATGCATCAGGGGCCAGG + Intergenic
1199772018 X:150981167-150981189 GTCTGTCTGGAGAAAAGGCCTGG + Intronic