ID: 1090974095

View in Genome Browser
Species Human (GRCh38)
Location 11:131667299-131667321
Sequence CTTTCTAGGCAGAAGGAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 1, 2: 3, 3: 21, 4: 226}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090974095_1090974098 1 Left 1090974095 11:131667299-131667321 CCTTACTCCTTCTGCCTAGAAAG 0: 1
1: 1
2: 3
3: 21
4: 226
Right 1090974098 11:131667323-131667345 ACTTCTGATCCCTCTGTTACTGG 0: 1
1: 0
2: 0
3: 12
4: 138
1090974095_1090974099 2 Left 1090974095 11:131667299-131667321 CCTTACTCCTTCTGCCTAGAAAG 0: 1
1: 1
2: 3
3: 21
4: 226
Right 1090974099 11:131667324-131667346 CTTCTGATCCCTCTGTTACTGGG 0: 1
1: 0
2: 5
3: 49
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090974095 Original CRISPR CTTTCTAGGCAGAAGGAGTA AGG (reversed) Intronic
901210191 1:7520251-7520273 GTTTTTAGGCAGGAGGAGGAGGG - Intronic
903798563 1:25949103-25949125 CATTCCAGGCAGAAGAAATAAGG - Intergenic
904794342 1:33047797-33047819 ATTTCTAGGCAGAAGGTTTAAGG - Intronic
904948117 1:34214202-34214224 CATTCCAGGCAGGAGGAGCAAGG + Intronic
904976495 1:34460905-34460927 CTTCCTAGGCAGAAGGAACAAGG + Intergenic
905267198 1:36762822-36762844 CATTCTAGGCAGAGGGAACAGGG + Intergenic
905503985 1:38462050-38462072 CTTACTAGGCAGAAGATGGAAGG - Intergenic
905510523 1:38516092-38516114 CTTTGTAGGCGGAAGGAATGAGG + Intergenic
906174291 1:43756746-43756768 CCATCTAAGCACAAGGAGTAAGG + Intronic
909984523 1:82144152-82144174 CTTTATAGGCAGCATGAGAATGG + Intergenic
911286807 1:96004701-96004723 CATTCTTGGAAGAAGGGGTAGGG + Intergenic
912905723 1:113704749-113704771 CTTTCCTGGCAGAAGTAATATGG + Exonic
913098709 1:115543434-115543456 CATTCCAGCCAGCAGGAGTAAGG + Intergenic
913478641 1:119263317-119263339 CTTTTTAAGCAGTAGCAGTATGG + Intergenic
915606869 1:156957740-156957762 CTTTCAAGGTGGAAGGAGTGGGG - Intronic
917204257 1:172553967-172553989 ATCTGTAGGCAGAAGGACTAAGG + Intronic
917710781 1:177681845-177681867 GTTTCCAGGCAGATGGAGAAGGG + Intergenic
918101040 1:181374825-181374847 CTCTCTAGGCAGTAAGAGAAGGG - Intergenic
918525178 1:185456873-185456895 CCTTCCAGGCAGAGGGAGCAGGG - Intergenic
923058893 1:230452205-230452227 TTTTCCAGGTAAAAGGAGTAGGG - Intergenic
923405572 1:233655690-233655712 CTCACAAGGCAGAAGGAGGAAGG - Intronic
923601693 1:235409241-235409263 ATTGGTAGGCAGAAGGAGGAAGG + Intronic
924250150 1:242124421-242124443 CTTTGGAGGAAGAAGGAGAAGGG + Intronic
924748404 1:246860478-246860500 CTTTCTAAGCTGAAGGAGTAAGG + Intronic
1063447248 10:6127129-6127151 TTTTCCAGGCTGAAGGAGTTGGG - Intergenic
1063597830 10:7453162-7453184 CATTCTAGGTAGAGGGAGTGAGG - Intergenic
1065094489 10:22267199-22267221 CTGTCTAGGCTGAAGGAATAAGG + Intergenic
1071002830 10:80850184-80850206 ATTGTTAGACAGAAGGAGTAAGG + Intergenic
1071087447 10:81879054-81879076 CTTTAAAGGCAGGAGGAGAAAGG + Intronic
1071439719 10:85679588-85679610 TTTTCCAGGCAGAAGGAACAAGG + Intronic
1071450855 10:85790523-85790545 CTGTCTGGGCAGAGGGAGTGGGG + Intronic
1071696248 10:87875393-87875415 TTTTTTAATCAGAAGGAGTATGG + Intronic
1074769775 10:116725633-116725655 CTTTGCTGGCAGAAGGAGTGGGG + Intronic
1075952454 10:126493278-126493300 CTCTCTGGGCAGTAGGATTATGG + Intronic
1078490177 11:11761016-11761038 CTGTCTTGGAAGAAGGAGGAAGG - Intergenic
1079276016 11:19038411-19038433 CTTTCTAGGAAGAGGCTGTAGGG - Intergenic
1079842191 11:25417385-25417407 CCTTCTTGGCAGAAGAAGCATGG + Intergenic
1080512808 11:32991664-32991686 CTTGGTAGGCAGAAGAAATATGG - Intronic
1082708650 11:56525752-56525774 CTGTCGTGGCAGAAGGAGAAAGG + Intergenic
1083160571 11:60851724-60851746 CTTCCAAGGCAGAAGCAGCAGGG - Exonic
1084694477 11:70745463-70745485 TTTTCAAGGCAGCAGGAGGAGGG - Intronic
1084762863 11:71284919-71284941 CTTTCTAGGAAAAAGGAGAAGGG + Intergenic
1086920041 11:92575804-92575826 GTTAATAGGCAGAAGGAGGAAGG + Intronic
1086931235 11:92695164-92695186 CTGTCTGGTCAGAAGAAGTAAGG + Intronic
1090230725 11:125101453-125101475 CTGTCTAGGAAGAAGGACTTTGG - Intronic
1090441539 11:126728937-126728959 CTTTCGGGGCAGAGGGAGGAGGG + Intronic
1090974095 11:131667299-131667321 CTTTCTAGGCAGAAGGAGTAAGG - Intronic
1091067568 11:132530531-132530553 CATTCTGGGGTGAAGGAGTAAGG - Intronic
1091768610 12:3137582-3137604 CTTTCCAGCCAGATGGAGGAGGG + Intronic
1091844225 12:3643018-3643040 CTTTCAAAGCAGAATGAGTTTGG + Intronic
1092232903 12:6787058-6787080 CTTTCTAGTCTGAAGGAAGAAGG + Intronic
1092752597 12:11732689-11732711 CTCTAGAGGCAGAAGGAGGACGG - Intronic
1094143779 12:27207736-27207758 CATTCCAGGCAGAAGGAGGTAGG - Intergenic
1097879183 12:64671646-64671668 CTTCCTTGGCAGGAGGAGGAAGG + Intronic
1100057281 12:90527243-90527265 CTTTTTATTCACAAGGAGTATGG + Intergenic
1100504567 12:95206839-95206861 ATTTTTAGGCAAAAGGAGGAAGG + Intronic
1101210861 12:102534157-102534179 CTTTCTAGGTACATGGTGTAAGG - Intergenic
1102880187 12:116479014-116479036 CTTTCTGGGCAGAGGGGTTATGG + Intergenic
1104413030 12:128575088-128575110 CTTTCTCGGCAGTAGGATTATGG + Intronic
1107023583 13:35777020-35777042 CTTTCTAGGCAGGACAAGTAAGG - Intronic
1108157691 13:47603350-47603372 TTTTCTAGGCAGAGAGAGAAAGG + Intergenic
1108729038 13:53213823-53213845 CGTCATAGGCAGAAGGAGGAAGG - Intergenic
1110194416 13:72770349-72770371 CTTTCTAGGCAGAAAAACAAGGG - Intronic
1112214170 13:97413002-97413024 TCTTCTAGGCAGAAGGAACATGG - Intergenic
1114348927 14:21828331-21828353 TTTTGTAGGTAGAAGGAGTAGGG + Intergenic
1114350440 14:21844566-21844588 CTTTCTAGGATGAATGAGGAGGG + Intergenic
1115736103 14:36331832-36331854 CTTTCTAGGTAGATGAAGAAAGG + Intergenic
1116012951 14:39372171-39372193 CTGTGTAGGCAGAAACAGTAGGG + Intronic
1118294881 14:64559587-64559609 CATTCTAGGGAGAAGGAACATGG + Intronic
1122195123 14:100078989-100079011 CTTTCCAGGAAGGAGGAGTGTGG + Intronic
1202904731 14_GL000194v1_random:61774-61796 CTTTCTTGGCAAAAGAAGAAAGG + Intergenic
1126815092 15:52446628-52446650 TTTTCTAGGCTGAAGGTGCAAGG - Intronic
1127737537 15:61858174-61858196 CATTCTAGGTGGAAGGAGAACGG - Intronic
1129772491 15:78211734-78211756 CTGGCAAGGTAGAAGGAGTAAGG - Intronic
1130751704 15:86719496-86719518 CTTTCTATGCATAGGGAGCAGGG + Intronic
1132141974 15:99404196-99404218 CTGTCTATGAAGAAGGAGCAGGG + Intergenic
1135528554 16:23232751-23232773 GTTGCTAGGGAGTAGGAGTAGGG - Intergenic
1138812794 16:60170772-60170794 CTTTCAAGACAGAAGGAATACGG + Intergenic
1139804696 16:69554735-69554757 CATGCTAGGCAGGAGGAGGAAGG - Intergenic
1143863587 17:9908383-9908405 CTCTCCAGGCACAAGGAGGAAGG + Intergenic
1143992489 17:10978114-10978136 CATTCCAGGCAGAAGTAATAGGG - Intergenic
1146477107 17:33171868-33171890 CTTTCCAGGCAGACGGAACAAGG - Intronic
1147165625 17:38591699-38591721 CCTTCCAGGCAGGAGGAGTCAGG - Intronic
1148450133 17:47772072-47772094 CTTTCTAGGCAGCAGGATGGAGG + Intergenic
1153626353 18:7025295-7025317 CGTTCTAGGCAGATGGAGCTGGG - Intronic
1153951495 18:10061389-10061411 CTTTCTAGGGGGAGGGAGCAGGG - Intergenic
1155959677 18:31983484-31983506 CTCTCAAGCCAGAAGAAGTATGG + Intergenic
1157079131 18:44502835-44502857 GTTTCAAGGCATAAGGAGTCAGG - Intergenic
1157241581 18:46014939-46014961 TTTTCTAGGCAGACTGAGAAGGG + Intronic
1157412956 18:47479153-47479175 GTTTGTGGGCAGAATGAGTATGG + Intergenic
1157619469 18:49007970-49007992 CTTTGGAGGCAGTAGGAGAATGG + Intergenic
1160841366 19:1148242-1148264 CTTTCTATGCAGGAGGAGAGTGG - Intronic
1162106151 19:8371044-8371066 CTTTCTGGGCAGATGGAGGCTGG + Exonic
1164975008 19:32566406-32566428 CTTTCTGGGCTCAAGGAGCATGG - Intergenic
1165576194 19:36821100-36821122 TTTTCAAGGGAGAAGGAGTCTGG + Intronic
1168481466 19:56723840-56723862 CTTTCTAGCCACCAGGAGTGAGG + Intergenic
926980625 2:18563384-18563406 CTTCAAAGGTAGAAGGAGTATGG - Exonic
929063433 2:37947457-37947479 CTTGCGAGGCAGAAAAAGTATGG - Intronic
929486086 2:42356134-42356156 CATTCTAGGCAGAGGGAACATGG - Intronic
930506958 2:52294647-52294669 CTTTTTTGGGAGAAAGAGTAGGG - Intergenic
930748016 2:54904553-54904575 CATTCCAGGCAAAAGGAATATGG + Intronic
931285766 2:60830338-60830360 CATGCCAGGCAGAAGGAGGAAGG + Intergenic
931424360 2:62157470-62157492 CTTTTCAGGCAGAATGAGTGAGG - Intergenic
935426980 2:102929892-102929914 CGTTCTAGGCAGAAGGGGGGAGG - Intergenic
935891149 2:107679862-107679884 CTTTATAGGCAGAATGAGTAGGG + Intergenic
936630622 2:114199018-114199040 CTTTCCAGGCTGAGGGAGAAAGG - Intergenic
939181201 2:138804288-138804310 ATTGCAAGGCAGAAGGAGTTTGG + Intergenic
939714165 2:145562143-145562165 CTTTATAGTCAGAAGGAATCAGG + Intergenic
939715463 2:145578529-145578551 CATTCTAGGTAGAAGGAATGAGG + Intergenic
941149350 2:161894439-161894461 ATTTCTAGAGGGAAGGAGTAAGG - Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942286541 2:174423264-174423286 ATTTGTACGAAGAAGGAGTAGGG - Intronic
945582992 2:211620563-211620585 CTTCCTAGGCAGAATGAATAGGG + Intronic
945586051 2:211664430-211664452 CTTTATGGGCAGTAGGAGGATGG + Intronic
1168880555 20:1202922-1202944 CATTCAAGGCAGAAGGAAAAGGG + Intergenic
1170422960 20:16210696-16210718 TGTTCTAGGCAGAAAGAGCAGGG - Intergenic
1170586370 20:17737324-17737346 TTTTCTAGGGAGTAGGAGTAGGG - Intergenic
1170734936 20:19006396-19006418 CTTTCTTGGCAGGAGGAGGTGGG + Intergenic
1171316409 20:24199572-24199594 TTTTCCAGGCAGTAGGATTAAGG + Intergenic
1172514125 20:35521423-35521445 CATTCCAGGCAGAGGGAGCAAGG + Intergenic
1173628153 20:44489113-44489135 CTTTCTGGGCTGAAAAAGTAAGG + Intronic
1173694437 20:44996473-44996495 CTTTTTTGGGAGAAGGAGTGAGG + Intronic
1174602412 20:51735379-51735401 CCTTTCAGGAAGAAGGAGTAGGG + Intronic
1174925857 20:54759213-54759235 CTTTCTAAGCAGAAGTATTTAGG - Intergenic
1175057205 20:56209108-56209130 CTGGCTAGGCAGAAGGTGGAGGG - Intergenic
1175080652 20:56417738-56417760 CTTTCTAGTCAGCAGGTGTTTGG + Intronic
1175647969 20:60692155-60692177 CTTTTTAGCCAGAATGAGTGAGG + Intergenic
1176624101 21:9076541-9076563 CTTTCTTGGCAAAAGAAGAAAGG + Intergenic
1176989528 21:15478573-15478595 ATTACTAGGCAGAAGCAGTATGG + Intergenic
1179110253 21:38439957-38439979 TATTCTAGGCAGAAGGAGGTGGG + Intronic
1180581565 22:16844179-16844201 CTCTGTAGGCAGAGGGAGGAGGG + Intergenic
1182018306 22:27059766-27059788 CTTCCTAGCCAGCATGAGTATGG + Intergenic
1182092016 22:27602431-27602453 CTTTCCAGGCAGAAAGGGCAAGG + Intergenic
1183717746 22:39543751-39543773 CTTTCTGAGCAGGAGGAGTGGGG - Intergenic
1184694995 22:46134116-46134138 CTTTCCAGGTAGAAGGGGTGGGG - Intergenic
949573155 3:5312598-5312620 CTTTCCATGCAGAAGGAGGAAGG - Intergenic
950786697 3:15442948-15442970 CATTCCAGGCAGAAGGAATCTGG - Intronic
950923642 3:16718650-16718672 CATTCAAGGCAGAAAGAGAAAGG + Intergenic
952470782 3:33649121-33649143 CATTCTAGGCAGAAGAAGCAAGG - Intronic
955466596 3:59243419-59243441 CTCACAAGGCAGAAGGAGTGAGG - Intergenic
956937246 3:74117085-74117107 CATTCTAGGCAGAAGGAGCAGGG - Intergenic
958444727 3:94201573-94201595 CCTCCAAGACAGAAGGAGTAAGG - Intergenic
959089687 3:101888769-101888791 CCTTCAAGGCAGAAGCAGAAGGG + Intergenic
959212735 3:103409746-103409768 CATTCTAGGCAGAAAGAGGCAGG + Intergenic
961219158 3:125186402-125186424 ATTTTTAGGCAGCAGGAGCAGGG - Intronic
963077210 3:141358217-141358239 CTTTCCAGGCAGAAATATTAGGG + Intronic
963998092 3:151734907-151734929 CTGGCTTGGCAGAAAGAGTATGG - Intronic
964851607 3:161102128-161102150 CTTTCTATGCAAAAGCAGAATGG - Intronic
965947038 3:174255527-174255549 CTTTGCAGTCAGAAGGAGTTTGG - Intronic
967258905 3:187622414-187622436 CTGTCTAGGGAGATGGAGGATGG - Intergenic
969241939 4:5904712-5904734 TTTCCTAGGGAGAAGGAGCATGG - Intronic
970201228 4:13608654-13608676 TTTTCTAGGCAGGAGTAGTGTGG - Exonic
970328846 4:14957769-14957791 CTTTCTCCACAGAAGGAGGAAGG + Intergenic
970894711 4:21088673-21088695 GTTAATAGGAAGAAGGAGTAGGG - Intronic
973288822 4:48449309-48449331 ATTTCTAGGCAGAAGGCTTCAGG + Intergenic
976813035 4:89117653-89117675 CTAGCCAAGCAGAAGGAGTAGGG + Intergenic
978314924 4:107425161-107425183 CTTTCACGGCAGAAGGTGAAGGG + Intergenic
978896616 4:113896008-113896030 TCTTCTAGGCAGAAAGAGAAAGG + Intergenic
979528372 4:121741258-121741280 CCTTCTAGGCAGAGGGAATAGGG - Intergenic
979913784 4:126404801-126404823 ATTTCTGTACAGAAGGAGTAGGG - Intergenic
980395846 4:132214139-132214161 CTTTGTAGGCAGGAGGCATATGG + Intergenic
980732283 4:136838379-136838401 CAATCAAGGCAGAAGGAGAAGGG - Intergenic
981146508 4:141331880-141331902 ATTTCCAGGTAGAAGGAGTTAGG - Intergenic
983072307 4:163283066-163283088 TCTTCTGGGCAAAAGGAGTAGGG + Intergenic
985652997 5:1115691-1115713 CTTTCTGGTGAGAAGGAGTGTGG - Intergenic
985812447 5:2099646-2099668 CTTTCTATGCAGGAGGAGTGGGG - Intergenic
986965375 5:13264152-13264174 CTGTATATGCAGAAAGAGTAAGG - Intergenic
987341387 5:16942560-16942582 CTTTGGAGGGAGAAGGAGAAGGG - Intergenic
987466834 5:18282061-18282083 CTCTCCAGACAGAAGGAGGAGGG - Intergenic
987798623 5:22664336-22664358 CTATCTAGGAAGAAGGTGAAGGG + Intronic
988181872 5:27806082-27806104 CTTTATGGTGAGAAGGAGTAGGG - Intergenic
988518435 5:31924849-31924871 TCTACTAGGCAGAAGGAATAAGG - Intronic
988717223 5:33840318-33840340 CTTCCTAAACAGAAGTAGTAAGG - Intronic
990306075 5:54495026-54495048 CTTTCTCAACAGATGGAGTAGGG + Intergenic
990327719 5:54694609-54694631 CATTCCAGGCAGAAGGAGGAGGG + Intergenic
990336358 5:54776568-54776590 CTTTCTTAGCAGAATGAGAATGG - Intergenic
990392972 5:55346329-55346351 GTTTCTATGGAGGAGGAGTACGG - Intronic
990718611 5:58667515-58667537 CTTCCTAGGCAACAGGAGTCTGG - Intronic
990927679 5:61046990-61047012 CTTTCTAGGCAGAAGAAGTATGG + Intronic
991007055 5:61839396-61839418 GTTTTCAGGCAGAAGGAATATGG - Intergenic
991414559 5:66379141-66379163 CATTGTAGGCAGAAGGAGAGGGG + Intergenic
992195315 5:74333454-74333476 CATTCCAGGCAGAAGGAACAGGG - Intergenic
992229978 5:74654575-74654597 CTTTCTAGGCAGATGAGGGAAGG + Intronic
992271828 5:75072377-75072399 CATTCTAGGCATTAGGAATAAGG - Intronic
992590168 5:78286433-78286455 CTTACTGGGCAGAAGGTGGAAGG - Intronic
992857679 5:80879730-80879752 GTTTCTAAGCTGAAGGAGTTTGG - Intergenic
995927258 5:117388814-117388836 CTGTCTAGGAAGAAGGTCTAAGG + Intergenic
999394591 5:151219258-151219280 CATGCTAGGCAGAAGGAATATGG - Intronic
1000927644 5:167213385-167213407 CTCACCAGGCAGAAGGGGTAAGG + Intergenic
1001526132 5:172430235-172430257 ATTTGTAGGGAGAAGGAGCAGGG - Intronic
1002660214 5:180786635-180786657 CGTTTTAGGAAGAAGGAGGAAGG - Intergenic
1003788640 6:9516652-9516674 CTTCCTTGGCAGGAGGAGGAAGG + Intergenic
1004365992 6:15013181-15013203 TGTTCTAGGCACAGGGAGTATGG + Intergenic
1007811917 6:44492266-44492288 CAATCTTGGCAGAAGGAGAAAGG - Intergenic
1011002056 6:82601538-82601560 CTTTCTGGACAGAAGAAATAAGG - Intergenic
1011192664 6:84749120-84749142 CTTTCAAGGCTGATGGGGTAGGG + Intronic
1011634317 6:89356213-89356235 TTTTCTAAGCAGGAGGATTATGG - Intergenic
1012349759 6:98235744-98235766 CTTTCATGGCAGAAGGTGAAGGG + Intergenic
1013711970 6:112911905-112911927 CTTGCTAGGCAGAAGTAATGTGG - Intergenic
1014269393 6:119319868-119319890 TTTTCAAGGCAGAAGGAAGAGGG - Intronic
1016005007 6:139080173-139080195 CTTTCTAATCAGAAGGAGGAGGG + Intergenic
1016899901 6:149091077-149091099 CTATCAAGACAGATGGAGTAAGG + Intergenic
1016994426 6:149951680-149951702 CTTAATAGGATGAAGGAGTAGGG - Intergenic
1017183796 6:151579649-151579671 CTTTCTAGGAAGAACAAATAAGG - Intronic
1019131879 6:169882955-169882977 CATTCTGGGCAGAAGCAGTGAGG + Intergenic
1021507398 7:21401058-21401080 CTTTCTGGGCCAAAGGAATAAGG - Intergenic
1026332926 7:69368716-69368738 CTTTCAAGGCAGAAGAAAGAAGG + Intergenic
1028240965 7:88420161-88420183 CTTTCTAGGGAGAAGGGGAAAGG + Intergenic
1030012739 7:105187307-105187329 ATTTCTAGGCAGAAGAGATAAGG - Intronic
1031192436 7:118570986-118571008 CTTACTTGGCAGGAGGAGAAAGG + Intergenic
1032564519 7:132928123-132928145 CTTCCTAGTCAGAATGAGGAAGG + Intronic
1033023704 7:137752962-137752984 CTGTCTAGGAAGGATGAGTAGGG - Intronic
1033595744 7:142856598-142856620 CACTCTAGGTAGAAGGAGGATGG + Intronic
1038085490 8:24192231-24192253 GTTTCAAGGCAGCAGGAGAAAGG - Intergenic
1039186627 8:34924486-34924508 CCTTCCAGCCAGAGGGAGTAAGG + Intergenic
1041576763 8:59406195-59406217 GTTTCAAGCCAGAAGGAGCAGGG - Intergenic
1041869574 8:62617606-62617628 CTTTCTATGCAACAGGAGAAAGG - Intronic
1042862269 8:73326759-73326781 ATTTCAAGGCACAAGAAGTAGGG + Intergenic
1043436797 8:80242991-80243013 ATTTCAAGGCTGTAGGAGTAAGG - Intergenic
1044920305 8:97162999-97163021 CTTTCTAGCAAGAAGGAAGATGG - Intergenic
1045559075 8:103243644-103243666 CTGCTTAGGCAGAAGGAGCAGGG + Intergenic
1047269658 8:123343928-123343950 TATTCCAGGCAGAAGCAGTATGG + Intronic
1056231769 9:84553435-84553457 CTTTCTAGGAAGAAGTATTATGG - Intergenic
1057409509 9:94805134-94805156 CATTCTAGGCAGACGGGTTATGG + Intronic
1057471535 9:95361236-95361258 ATTTCAAGGCAGAATGAGTCAGG - Intergenic
1057561392 9:96130670-96130692 TTTTCCAGGCAGAAGGGGAATGG + Intergenic
1059107451 9:111524038-111524060 CATTCTAGACTGAAGGAGCAAGG - Intergenic
1059142980 9:111871420-111871442 CTAACTAGGGAGAAGGAGTCAGG + Intergenic
1059399288 9:114058912-114058934 CTTTCTGGGCAGAAGCAGGTGGG - Intergenic
1059987651 9:119835822-119835844 TTTTCTAGGCACAAGGAGAGGGG - Intergenic
1060266319 9:122113514-122113536 CTGTCCATGCTGAAGGAGTAGGG + Intergenic
1060542848 9:124442567-124442589 CATTCAAGGCAGAAGGAAGAGGG + Intergenic
1060692437 9:125675707-125675729 CTTTGTTGCCAGAAGGAATATGG - Intronic
1203747282 Un_GL000218v1:46969-46991 CTTTCTTGGCAAAAGAAGAAAGG + Intergenic
1203562819 Un_KI270744v1:72511-72533 CTTTCTTGGCAAAAGAAGAAAGG - Intergenic
1187552646 X:20321638-20321660 CATTCTAGGCAGAAGGTACATGG + Intergenic
1188100827 X:26081754-26081776 CTTTCTAGGCAGAATTCCTAAGG - Intergenic
1189052083 X:37656437-37656459 CATTCTAGGCAAAAGGAACATGG - Intronic
1192867524 X:75151079-75151101 TTTTCTAGGGAGAAGGTCTATGG + Intronic
1194429056 X:93777981-93778003 CATTCTAGCCAGAAGGACAAAGG + Intergenic
1194685716 X:96911568-96911590 CTTTCCAAGTAGAAGGATTAAGG - Intronic
1195044204 X:101041466-101041488 CTCTCTAGGGAGATGGAGTCTGG + Intronic
1195179095 X:102339557-102339579 GTTTCTAGGCAGAAGGGGGTGGG - Intergenic
1197625877 X:128801955-128801977 CTTTCTGGGGAGAATGAGGATGG - Intergenic
1198030110 X:132746613-132746635 CTTCCTAGGCAGAGGGAGTGAGG - Intronic
1198099004 X:133407581-133407603 CTATCTAGGGAGAAGCAATATGG - Intronic
1198184679 X:134241950-134241972 TTTTTTATGCAGAACGAGTATGG - Intronic
1198232555 X:134705861-134705883 CGTACTTGGCAGAAAGAGTAGGG - Intronic
1199927816 X:152487225-152487247 TTTGCTAGGCAGATAGAGTAGGG - Intergenic
1200208028 X:154332056-154332078 GGTTCTAGGCAGAAACAGTAGGG + Intergenic
1201160603 Y:11161962-11161984 CTTTCTTGGCAAAAGAAGAAAGG + Intergenic
1202224130 Y:22583571-22583593 GTTGCTGGGCAGATGGAGTATGG - Intergenic