ID: 1090974959

View in Genome Browser
Species Human (GRCh38)
Location 11:131672647-131672669
Sequence TATTGGCACCAGAGTCTAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 63}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090974959_1090974967 29 Left 1090974959 11:131672647-131672669 CCCACTAGACTCTGGTGCCAATA 0: 1
1: 0
2: 1
3: 4
4: 63
Right 1090974967 11:131672699-131672721 TAGTACTCCTGGTACATAGTAGG 0: 1
1: 0
2: 2
3: 19
4: 186
1090974959_1090974968 30 Left 1090974959 11:131672647-131672669 CCCACTAGACTCTGGTGCCAATA 0: 1
1: 0
2: 1
3: 4
4: 63
Right 1090974968 11:131672700-131672722 AGTACTCCTGGTACATAGTAGGG 0: 1
1: 0
2: 2
3: 9
4: 120
1090974959_1090974966 18 Left 1090974959 11:131672647-131672669 CCCACTAGACTCTGGTGCCAATA 0: 1
1: 0
2: 1
3: 4
4: 63
Right 1090974966 11:131672688-131672710 ACTTAGGTATTTAGTACTCCTGG 0: 1
1: 0
2: 0
3: 2
4: 95
1090974959_1090974965 2 Left 1090974959 11:131672647-131672669 CCCACTAGACTCTGGTGCCAATA 0: 1
1: 0
2: 1
3: 4
4: 63
Right 1090974965 11:131672672-131672694 AAAGGGACACAATTCTACTTAGG 0: 1
1: 0
2: 1
3: 19
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090974959 Original CRISPR TATTGGCACCAGAGTCTAGT GGG (reversed) Intronic
907223056 1:52921361-52921383 TAGTGGCTCCAGACTCTAGCTGG - Intronic
911646085 1:100338374-100338396 TATTGCTACAAGAGTCTATTCGG + Intergenic
922011877 1:221596909-221596931 TATTAGCAACAGAGGCTAATTGG - Intergenic
1068093998 10:52467481-52467503 AATTGGCACTAGAGATTAGTGGG - Intergenic
1068573624 10:58658915-58658937 AATTGGCACTAGAGTGTAATTGG + Intronic
1070614569 10:77959472-77959494 TACTGGCAGCAGAGTCCAGCTGG - Intergenic
1070616180 10:77971033-77971055 TATTGGCGCCAGGATATAGTAGG + Intronic
1071175872 10:82926034-82926056 TATTGGCTCCAAAGTACAGTTGG + Intronic
1073001714 10:100290647-100290669 TATTGTCTCCAGAGTCTGGGAGG - Intronic
1074814401 10:117133854-117133876 AATTGGTAGCAGAGTCTAGTGGG + Exonic
1076308294 10:129481086-129481108 TATTGACACCAAACTCTAGGAGG - Intronic
1077678119 11:4215250-4215272 CATAGGCACTAGAGTCTAGAGGG + Intergenic
1087236640 11:95726364-95726386 TATTTCCACCAGAGTCTTCTCGG - Intergenic
1088543054 11:110933447-110933469 TATTGTCACAAGAGACTATTTGG - Intergenic
1090974959 11:131672647-131672669 TATTGGCACCAGAGTCTAGTGGG - Intronic
1094675093 12:32612088-32612110 CATTGGCACCAAAGTCTGGAAGG - Intronic
1097253775 12:57656248-57656270 GATGGGCTCCTGAGTCTAGTGGG + Intergenic
1112077660 13:95931345-95931367 CCTGGGCTCCAGAGTCTAGTGGG - Intronic
1113100981 13:106717987-106718009 TATTGGCCTCAGAGAATAGTTGG + Intergenic
1113336435 13:109380899-109380921 TATTGTGACCAGAGTCTTGAAGG + Intergenic
1114917618 14:27287924-27287946 TATTGGCCCAAGAGTCTGGAGGG - Intergenic
1123986928 15:25654434-25654456 TATTGGCACAATAGTCTGTTTGG + Intergenic
1142730510 17:1852217-1852239 TATTGACAGTACAGTCTAGTAGG + Intronic
1147573442 17:41585582-41585604 TATTGGCCCCTGAGTCTGGTTGG + Intronic
1148088744 17:45009967-45009989 GAGTGGCAACAGAGTCTGGTGGG + Intergenic
1149981360 17:61313921-61313943 TGCTGGCTCCAGAGTCTCGTGGG + Intronic
1153493589 18:5674774-5674796 CATTAGCACCAGATTCTATTTGG - Intergenic
1153860868 18:9204066-9204088 TACTGTCTCCAGAGTCGAGTTGG + Intronic
1156594554 18:38533043-38533065 TGTGGGCACCAGAGTCTACAGGG - Intergenic
1156969759 18:43139973-43139995 GCTGGGCTCCAGAGTCTAGTGGG + Intergenic
1158225521 18:55197305-55197327 TATTCCCACCAGAGTCTAGTCGG + Intergenic
1159231659 18:65615418-65615440 TATTGGCACCTTAGTCTTGGAGG + Intergenic
1163597535 19:18228887-18228909 TAAAGGCACCAGAGACTACTGGG - Intronic
925533478 2:4890635-4890657 GTATGGCAACAGAGTCTAGTTGG + Intergenic
928082150 2:28321015-28321037 TATTGGTACCAGACACTAGTTGG + Intronic
940631693 2:156248168-156248190 TCTTGGTACCACACTCTAGTAGG + Intergenic
944805364 2:203275863-203275885 TTGTGGCACCACATTCTAGTGGG + Intronic
945595670 2:211788041-211788063 TGTTGACACAAGAGTCAAGTTGG + Exonic
947642240 2:231713664-231713686 GATGGGCAGCAGAGTCTGGTGGG + Intergenic
948095189 2:235327776-235327798 TCTTGGCACCAGATTCCAGAAGG + Intergenic
1169532644 20:6502132-6502154 TATTTGCACCAGTGTATGGTTGG + Intergenic
1173719216 20:45238638-45238660 TCTTGTCACCAGACTCTAGCAGG - Intergenic
1180234687 21:46450829-46450851 TATTGGGATCAGAGTCTTGGGGG - Intergenic
1181988650 22:26820099-26820121 TTTTGGCACCAGTGACTGGTGGG - Intergenic
955510110 3:59671677-59671699 TATGGGCACCTGTGGCTAGTGGG + Intergenic
956695261 3:71913384-71913406 TTTTGGCATCACCGTCTAGTTGG + Intergenic
957174692 3:76791559-76791581 TATTGGCAAGAGACTTTAGTTGG - Intronic
964205441 3:154169838-154169860 TATTGTGACCAGAGGCTTGTAGG + Intronic
964540199 3:157771101-157771123 TTTGGGCATCAGAGTTTAGTTGG - Intergenic
993928184 5:93898968-93898990 AAATGGGATCAGAGTCTAGTTGG + Intronic
994720422 5:103373571-103373593 TATTGCTTCCAGACTCTAGTAGG - Intergenic
995206578 5:109487764-109487786 GATGGGCTCCTGAGTCTAGTGGG - Intergenic
996244223 5:121240682-121240704 AATTGGCTTCAGAGTCTATTTGG - Intergenic
998371236 5:141662991-141663013 TATTGTAACCAGAGGCTAGCAGG + Intronic
1003113901 6:3270603-3270625 TCTTGGGAGCAGAGTCCAGTGGG - Exonic
1009649212 6:66451637-66451659 TATTGGAGGCAGAGCCTAGTGGG + Intergenic
1015438541 6:133219762-133219784 TATTGTGACCAGAGACTTGTAGG + Intergenic
1016947942 6:149551522-149551544 TACTGGCACCAGTGTTAAGTGGG + Intergenic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1020483926 7:8697217-8697239 TCTTGGCACCACAGTCTACAAGG - Intronic
1022451522 7:30520288-30520310 TCTGGGCATCATAGTCTAGTAGG - Intronic
1022478171 7:30725539-30725561 TAATGGCACCTGACTCAAGTGGG + Intronic
1028719339 7:94011777-94011799 TCTGGGCTCCTGAGTCTAGTGGG - Intergenic
1047335266 8:123929864-123929886 TAGTGATACCACAGTCTAGTGGG + Intronic
1052300891 9:26951411-26951433 TTTTGGCACCAGAGTCTATGTGG - Intronic
1052620630 9:30904679-30904701 TGTTGTGACCAGAGTCTTGTAGG + Intergenic
1194807530 X:98347853-98347875 TATTGGCATCATTGTATAGTTGG + Intergenic
1195102939 X:101573891-101573913 AACTGGCACCAGGGTCTACTGGG + Intergenic
1201387830 Y:13462107-13462129 TATTGACACAATAGTCTATTAGG + Intronic