ID: 1090976235

View in Genome Browser
Species Human (GRCh38)
Location 11:131682892-131682914
Sequence GCACATTTTACCTACCAGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 87}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090976228_1090976235 18 Left 1090976228 11:131682851-131682873 CCGCTGTTTCCTGGGAAGCATGT 0: 1
1: 0
2: 1
3: 28
4: 203
Right 1090976235 11:131682892-131682914 GCACATTTTACCTACCAGCCGGG 0: 1
1: 0
2: 1
3: 7
4: 87
1090976231_1090976235 -10 Left 1090976231 11:131682879-131682901 CCACACTCCCTCTGCACATTTTA 0: 1
1: 0
2: 3
3: 32
4: 341
Right 1090976235 11:131682892-131682914 GCACATTTTACCTACCAGCCGGG 0: 1
1: 0
2: 1
3: 7
4: 87
1090976229_1090976235 9 Left 1090976229 11:131682860-131682882 CCTGGGAAGCATGTTGCGCCCAC 0: 1
1: 0
2: 1
3: 5
4: 91
Right 1090976235 11:131682892-131682914 GCACATTTTACCTACCAGCCGGG 0: 1
1: 0
2: 1
3: 7
4: 87
1090976230_1090976235 -9 Left 1090976230 11:131682878-131682900 CCCACACTCCCTCTGCACATTTT 0: 1
1: 0
2: 1
3: 28
4: 284
Right 1090976235 11:131682892-131682914 GCACATTTTACCTACCAGCCGGG 0: 1
1: 0
2: 1
3: 7
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090976235 Original CRISPR GCACATTTTACCTACCAGCC GGG Intronic
905152890 1:35946152-35946174 GGACATATTACCTAACAGCAAGG - Intronic
906970963 1:50513129-50513151 GCTGATTTTTCCTTCCAGCCTGG - Intronic
912485271 1:110022118-110022140 CCACATCTAACCTACCTGCCGGG - Exonic
916190788 1:162176122-162176144 TCACATTTTACATTCCATCCTGG + Intronic
916248681 1:162713994-162714016 GCCAATTTTACCTATCAGACTGG - Intronic
920097443 1:203495816-203495838 GCACAAATTCCCTACCAGCTGGG - Intronic
1065965017 10:30763830-30763852 GCGCATTTTGCCAACCATCCAGG + Intergenic
1071201916 10:83228824-83228846 GCACACAGTACCTACCAGGCAGG - Intergenic
1071389744 10:85160564-85160586 GCACACCTTACATAACAGCCAGG + Intergenic
1072307202 10:94119140-94119162 GTACACATTACCTACCAGCCTGG - Intronic
1075141539 10:119841883-119841905 GCTCATTTTACTCATCAGCCAGG + Intronic
1077469952 11:2752907-2752929 GCACAATTTCACTGCCAGCCAGG + Intronic
1078668347 11:13344101-13344123 GGGCATTCTCCCTACCAGCCAGG + Intronic
1080660743 11:34293933-34293955 TAACATTTTACCGACCAGCCTGG - Intronic
1081356468 11:42120505-42120527 GCACATCTTACATAGCAGCAGGG - Intergenic
1083195333 11:61082471-61082493 GCACGCTTTACTTTCCAGCCTGG + Intergenic
1083222092 11:61259091-61259113 ACAGACTTTACCTACAAGCCCGG - Exonic
1087611942 11:100445470-100445492 GGACATTTTTCCTATCAGCTTGG - Intergenic
1088179119 11:107089160-107089182 GCACAGTTTCACTACTAGCCAGG + Intergenic
1089747500 11:120627548-120627570 GCTCATTCCACCTCCCAGCCTGG - Intronic
1090976235 11:131682892-131682914 GCACATTTTACCTACCAGCCGGG + Intronic
1091065292 11:132504606-132504628 CTACATTTAACCTGCCAGCCTGG - Intronic
1091729354 12:2868552-2868574 GGACACATTACCTTCCAGCCTGG + Exonic
1092740827 12:11627890-11627912 GCACATTTTAGCTGCCTTCCTGG + Intergenic
1094213350 12:27915776-27915798 TCACATTTTAGCTTTCAGCCAGG - Intergenic
1094483152 12:30901046-30901068 GGACATTTCACTTACCAGTCTGG + Intergenic
1105399604 13:20077686-20077708 TCACATTATACATTCCAGCCAGG - Intronic
1107796250 13:44055104-44055126 GCAGATATTACTTATCAGCCTGG + Intergenic
1109566654 13:64125994-64126016 TCACATTTTACCTTTCAACCAGG + Intergenic
1110793762 13:79613653-79613675 GCACATCTTACATGCCAGCAGGG + Intergenic
1116652099 14:47606256-47606278 GCAAAGTTGATCTACCAGCCAGG + Intronic
1117523554 14:56575070-56575092 GGACATTCCACCTACCTGCCGGG - Intronic
1121088116 14:91162190-91162212 GCTCATTTTACCAAACAGCTGGG + Intronic
1121613710 14:95298768-95298790 GCATATTTAACCTAACATCCAGG + Intronic
1122752032 14:103943558-103943580 GCCCAGTTTACGGACCAGCCTGG - Intronic
1130445430 15:83996887-83996909 GGACATTTTCCCTACCAGTGTGG - Intronic
1130825663 15:87543331-87543353 GCACATTGGCCCTACCAGCAAGG + Intergenic
1138806687 16:60098626-60098648 GGAAATTTTACAGACCAGCCAGG - Intergenic
1146596008 17:34169425-34169447 GCACATTGTACCCAAGAGCCTGG - Intronic
1151445696 17:74162094-74162116 GCACCTTCTACTTCCCAGCCAGG + Intergenic
1152358265 17:79816954-79816976 GCACCTTTTTCATACCAGCCTGG - Intergenic
1156262508 18:35458702-35458724 GCACATTTCTCCTACCAGCCTGG - Intronic
1156821568 18:41379228-41379250 CCAAATTTTACCTTGCAGCCAGG - Intergenic
1157488396 18:48105740-48105762 GCACATTCTACACACCAGGCAGG - Intronic
1160132352 18:76237367-76237389 GCACACTGTCCCTCCCAGCCAGG + Intergenic
1161563718 19:4987897-4987919 CCACATTCAACCCACCAGCCAGG - Intronic
925352861 2:3214296-3214318 ACAGCTCTTACCTACCAGCCTGG - Intronic
925958361 2:8992087-8992109 GTACATTTTATCAACAAGCCTGG - Intronic
928129599 2:28640261-28640283 GCACCTTTTAGCCAGCAGCCAGG - Intronic
929633800 2:43494435-43494457 GTACATTTTACCTACCTTCTAGG - Intronic
932529518 2:72513212-72513234 TCACATTTTACATACAACCCAGG - Exonic
935560304 2:104552148-104552170 ACACATTTTGCCTACAAGTCTGG + Intergenic
943701265 2:190990321-190990343 TGACATTGTACCTACCAGCCAGG + Intronic
944785577 2:203066717-203066739 GCACACTTCACCTACCAGACGGG + Intronic
947341425 2:229143792-229143814 GCACATTTTACATAGCAGCAGGG - Intronic
1168936626 20:1671328-1671350 CCTCATTTTACCGACCAGGCTGG + Intergenic
1179099357 21:38343081-38343103 GGAGATTTTCCCTCCCAGCCAGG - Intergenic
1179964956 21:44797849-44797871 ACACATCTGACCCACCAGCCAGG + Intronic
949441513 3:4086125-4086147 GTATATTTTGCCTAACAGCCAGG - Intronic
949799932 3:7892636-7892658 GAATGTTTTACCTAGCAGCCTGG + Intergenic
950882395 3:16333868-16333890 GCAAATTAAAACTACCAGCCGGG + Intronic
956257776 3:67302893-67302915 GGGCATTTTACCTATCATCCGGG - Intergenic
963301281 3:143599964-143599986 TGGCGTTTTACCTACCAGCCCGG + Intronic
966748405 3:183299812-183299834 GCACTTTTTACCTTCGTGCCAGG + Intronic
971328166 4:25661343-25661365 GCGTGTTTTACCTACCACCCAGG - Intronic
980581805 4:134763904-134763926 GCTCATTTTACCTATCAACTTGG + Intergenic
982436732 4:155388930-155388952 GCACATTTTACTTAAAAGCTAGG - Intergenic
984679403 4:182590141-182590163 GAAAATTTTACCCACTAGCCTGG - Intronic
993805332 5:92400880-92400902 GCAAATCTTGCCTACCAACCAGG + Intergenic
994027677 5:95103760-95103782 GGCCATTTTACCCACCAGCATGG - Intronic
1000948285 5:167449269-167449291 GCAGATCTTACCTGACAGCCTGG + Intronic
1003729927 6:8810121-8810143 GCACCTTCTACCAACCACCCTGG + Intergenic
1005982337 6:30845924-30845946 GCTGATTTTACCCACCAACCTGG + Intergenic
1008593072 6:53013114-53013136 GCATGTCTTACCTACCAGACAGG - Intronic
1012500945 6:99887682-99887704 GCAGATTTTTCCTATCAGCATGG - Intergenic
1013367086 6:109444710-109444732 CCACATTTCACCTACCTTCCCGG + Exonic
1018634138 6:165846192-165846214 GGTCATTTCACCTACAAGCCTGG + Intronic
1021500584 7:21328816-21328838 GCATATTTAATCTATCAGCCAGG - Intergenic
1026973160 7:74480179-74480201 GGTCATTTTCCCTGCCAGCCTGG + Intronic
1027462061 7:78466636-78466658 TCACAGTTTACTTTCCAGCCAGG - Intronic
1030856406 7:114563017-114563039 GCACATCTTACATAGCAGCAGGG + Intronic
1035076060 7:156178449-156178471 GCACATTCTCCCCACCAGCCAGG + Intergenic
1036552747 8:9829341-9829363 GCACACTTAACTTTCCAGCCGGG + Intergenic
1042018358 8:64342525-64342547 GCACATTCTACAGTCCAGCCAGG - Intergenic
1044495653 8:92877605-92877627 GCACATTTCACATAGCAGCAGGG + Intergenic
1044977391 8:97678067-97678089 GTACATTATCCCTACCAGGCTGG - Intronic
1046208216 8:111032261-111032283 TCACATTTTACATTCCATCCTGG - Intergenic
1046729755 8:117712334-117712356 GCAATTTTTACCTCCCAGCATGG + Intergenic
1051628482 9:19121188-19121210 GCTCATTTTTCTCACCAGCCAGG - Intronic
1052060262 9:23951702-23951724 TCACATTTTACATACCAGATTGG - Intergenic
1060753534 9:126191579-126191601 CCACATTTCACCAGCCAGCCAGG - Intergenic
1188990798 X:36817643-36817665 GCACATCTTACCTGGCAGCAGGG + Intergenic
1191867796 X:65719660-65719682 GCAGATTTTACAGACCAGCTGGG + Intronic
1193534668 X:82699079-82699101 AAACATTTTTCCTACCAGTCGGG + Intergenic
1195710126 X:107766887-107766909 GCACATCTTATGTAACAGCCAGG - Intronic
1199851911 X:151729807-151729829 GCTCATTTTACCTTCCAAGCTGG + Intergenic