ID: 1090977063

View in Genome Browser
Species Human (GRCh38)
Location 11:131687625-131687647
Sequence CACTCCCACCCGAGGCACTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 157}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090977063_1090977072 19 Left 1090977063 11:131687625-131687647 CCCAAGTGCCTCGGGTGGGAGTG 0: 1
1: 0
2: 0
3: 12
4: 157
Right 1090977072 11:131687667-131687689 CACCGAAATATGAATGTCCAAGG 0: 1
1: 0
2: 0
3: 7
4: 134
1090977063_1090977070 -8 Left 1090977063 11:131687625-131687647 CCCAAGTGCCTCGGGTGGGAGTG 0: 1
1: 0
2: 0
3: 12
4: 157
Right 1090977070 11:131687640-131687662 TGGGAGTGGGGGATGCTGCAAGG 0: 1
1: 0
2: 4
3: 67
4: 691
1090977063_1090977071 -7 Left 1090977063 11:131687625-131687647 CCCAAGTGCCTCGGGTGGGAGTG 0: 1
1: 0
2: 0
3: 12
4: 157
Right 1090977071 11:131687641-131687663 GGGAGTGGGGGATGCTGCAAGGG 0: 1
1: 0
2: 3
3: 53
4: 427

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090977063 Original CRISPR CACTCCCACCCGAGGCACTT GGG (reversed) Intronic
901148009 1:7081049-7081071 CACTTCCAGCCCAGGCCCTTTGG - Intronic
906068872 1:43002904-43002926 CACTCCCTCCCCAGACTCTTGGG + Intergenic
906616406 1:47235603-47235625 CACCCCCACCCCAGGCGCTCCGG - Intergenic
907052229 1:51337285-51337307 CATTCCCACCTCAGGCCCTTTGG + Intronic
909116960 1:71549483-71549505 CTCTCCTTCCAGAGGCACTTGGG - Intronic
911543719 1:99190120-99190142 CACTCCCACCAGAAGCCCTATGG - Intergenic
912736170 1:112151371-112151393 CACTCCCACCCCACCCAGTTAGG - Intergenic
913170756 1:116230012-116230034 CACTCCCTTCTGAGGCTCTTGGG + Intergenic
915265273 1:154712333-154712355 CACTCCCACCCCAGGCTCCTAGG + Intronic
917767293 1:178235582-178235604 CACACGCACACGAAGCACTTAGG - Intronic
918009045 1:180569470-180569492 CACTCCCTCCAGAGGCTCTAGGG - Intergenic
919937984 1:202267413-202267435 CACTCCTAGCCGAGGCCCTTAGG - Intronic
920070761 1:203301439-203301461 CACTCCCACCCAAGGGTCTTGGG - Intergenic
921354945 1:214277104-214277126 CACTCCCTCCCGAGGCTCTAGGG + Intergenic
924553314 1:245098303-245098325 CACTCCAACCCCAGGCTCTCCGG - Intronic
1062919693 10:1270644-1270666 CACCCCAACCAGAGGAACTTAGG + Intronic
1063868960 10:10397712-10397734 CACTCCCTCCAGAGGCTCTAGGG - Intergenic
1063987701 10:11523811-11523833 CATTCCCACCAGAAACACTTGGG + Intronic
1068525770 10:58127724-58127746 CACTCCCTCCAGAGGCTCTATGG + Intergenic
1069159655 10:65078412-65078434 CAGTCCCACCCTTGGCACATGGG - Intergenic
1077017402 11:403126-403148 CACAGCCACTCGAGGCCCTTGGG - Exonic
1077857223 11:6140117-6140139 CACTCCAACCAAAAGCACTTTGG + Intergenic
1080282291 11:30571032-30571054 CACTACCAACAGAGGAACTTCGG + Intronic
1081173316 11:39894238-39894260 CACCTCCACACAAGGCACTTGGG - Intergenic
1081487077 11:43538974-43538996 CACCCCCACCCATGGGACTTGGG - Intergenic
1081763731 11:45594777-45594799 CCCTCCCACCCCAGGCTCTGAGG + Intergenic
1084682290 11:70673498-70673520 CACCCCCACCAGAGGGACTTGGG - Intronic
1085644888 11:78216547-78216569 CACTTGCACCCGAGGGATTTTGG + Exonic
1086508072 11:87527028-87527050 CACTCCAAACCCAGGCCCTTTGG - Intergenic
1087531199 11:99384471-99384493 CACCCCCAACCGAGGGACTCAGG + Intronic
1089607795 11:119651711-119651733 CACTATCACCCCAGGCACCTGGG + Intronic
1090977063 11:131687625-131687647 CACTCCCACCCGAGGCACTTGGG - Intronic
1091103828 11:132899923-132899945 CACTCCCACCCCAGGATCTCAGG + Intronic
1092537309 12:9402673-9402695 CCCTCCCACCCCCGGCTCTTAGG + Intergenic
1092557370 12:9570625-9570647 CCCTCCCACCCCCGGCTCTTAGG - Intergenic
1093801852 12:23383061-23383083 CACTCACACCCGAAGCTCTAGGG - Intergenic
1094513908 12:31117284-31117306 CCCTCCCACCCCCGGCTCTTAGG + Intergenic
1094514284 12:31118518-31118540 CCCTCCCACCCCCGGCTCTTAGG + Intergenic
1097747657 12:63317617-63317639 CACTCCCAGGTGGGGCACTTGGG - Intergenic
1100472386 12:94905185-94905207 GACACCCACCTGAGGCACTGAGG + Intronic
1101217201 12:102596226-102596248 CCCTCCCAGCTGGGGCACTTGGG - Intergenic
1102836178 12:116062778-116062800 CACTCCAACCTGGGCCACTTTGG - Intronic
1103508979 12:121461162-121461184 CACTCCCACCCCTGGCACGCAGG - Intronic
1105989293 13:25602507-25602529 CCCTCCAAACCAAGGCACTTTGG - Intronic
1108052539 13:46460581-46460603 CTCTCCCACCCCTGGCTCTTAGG + Intergenic
1108484529 13:50910368-50910390 CCCTCCCACCCGAGCCACCGGGG - Intronic
1108503723 13:51090657-51090679 CCCTCCCTCCAGAGACACTTAGG - Intergenic
1112554638 13:100455638-100455660 CACTACTACCCGAAGCATTTTGG + Intronic
1113964596 13:114145541-114145563 AGCTCCCACCCGTGGCATTTAGG - Intergenic
1114229306 14:20766136-20766158 CACTCCTACCTGAGCCACCTTGG - Intergenic
1114549643 14:23525517-23525539 CACCCCCACCTGAGGCCCTCGGG - Exonic
1115801890 14:37003977-37003999 CACTCCCACCAAAGCCAATTTGG + Intronic
1116983144 14:51192261-51192283 CACTGCCACCGGAGGACCTTTGG + Intergenic
1120472351 14:84942052-84942074 CACTCCAACCTGAGGCACAAAGG - Intergenic
1122018984 14:98820771-98820793 CACTTCCACCTGATGCTCTTGGG - Intergenic
1122112411 14:99511656-99511678 CACTGCCTCCCAAGGCACTCTGG + Exonic
1122372296 14:101235435-101235457 CACTCCAGCCCCAGGCCCTTGGG - Intergenic
1127963649 15:63908242-63908264 CACTCCCACCCCAGACTCTGAGG + Exonic
1128581315 15:68812207-68812229 CACTTCCAACTGTGGCACTTGGG - Intronic
1129119352 15:73386318-73386340 CTCTCCCATCCTAGGCACTTTGG + Intergenic
1129772975 15:78214350-78214372 CACTCACGCCAGAGGCAATTTGG - Intronic
1132586403 16:707413-707435 CACGCTCACCCTATGCACTTGGG - Intronic
1132880211 16:2158783-2158805 CACTGCCACCCTTGGCTCTTGGG + Intronic
1136054718 16:27680017-27680039 CACTCCCACCACATCCACTTGGG + Intronic
1138166815 16:54809908-54809930 CACTCCAACCTCTGGCACTTTGG - Intergenic
1138295755 16:55883816-55883838 CACTCCCAACTGATGCACCTGGG + Intronic
1141656642 16:85420278-85420300 CACTCCCTCCAGAGGTACTAGGG - Intergenic
1141762172 16:86035836-86035858 CACTCCCTCCAGAGGCTCTAGGG - Intergenic
1141897897 16:86970360-86970382 CACTCCCTCCAGAGGCTCTAGGG - Intergenic
1142408729 16:89905322-89905344 CACTCCAGCCCGAGGCACCCGGG - Intronic
1142962157 17:3557735-3557757 CAGTCCCACCCGGGGGCCTTGGG - Exonic
1143921548 17:10334205-10334227 CACTCCCACCCCGGCAACTTAGG - Intronic
1145974649 17:28977199-28977221 CACCCCCACCCAGGCCACTTGGG - Intronic
1146615922 17:34357321-34357343 CACTCCCACCCTAGACCCTGAGG - Intronic
1146917509 17:36687581-36687603 CCCACCCACCCGGGACACTTGGG - Intergenic
1148908200 17:50925002-50925024 ACCTGCCACCCCAGGCACTTGGG + Intergenic
1149334145 17:55618161-55618183 CAATCCCAACTGAGTCACTTAGG + Intergenic
1149595617 17:57862897-57862919 GACCCCCACCAGAGGCTCTTTGG - Exonic
1149897287 17:60438216-60438238 CACTCCCACCCCAGTCTCTCAGG + Intergenic
1150845376 17:68651847-68651869 CACCCACACCTGAGGCAGTTCGG + Intergenic
1151999217 17:77634872-77634894 CACTCCCTCTCGAGGCTCTAGGG + Intergenic
1154332492 18:13441242-13441264 CACTAACACCCGAGGCTCTAAGG - Intronic
1156475807 18:37404627-37404649 CACTCTCACCCCATACACTTTGG + Intronic
1160607086 18:80059337-80059359 CCCACCCTCCCGAGGCACTCGGG + Intronic
1160822752 19:1066150-1066172 CCCTCCCACCCGAGGTAGGTGGG + Exonic
1161358729 19:3834286-3834308 CCTTCCCAACCGAGGCACTCAGG - Intronic
1161543600 19:4867062-4867084 CACGCCCACCCGAGGGAAGTGGG + Intronic
927643684 2:24861719-24861741 CACTCCCTCCCAAGGCATTGGGG - Intronic
928138472 2:28706952-28706974 CACTCCCCCCAGAGGCTCTGGGG - Intergenic
934949784 2:98568235-98568257 TCCTCCCATCTGAGGCACTTAGG - Intronic
937906340 2:127054669-127054691 CAGAACCACCCGGGGCACTTGGG + Intronic
937927899 2:127182064-127182086 CACTCCCACCCTAGGCTCTCAGG - Intergenic
937993348 2:127675763-127675785 GACTCCCTCCCGAGGCACCCGGG + Intronic
941776198 2:169396103-169396125 CCCTCCCATCCCAGGCACTGCGG - Intergenic
942905321 2:181173573-181173595 AACTCCAACCCGAGGCAGATAGG - Intergenic
947112555 2:226734568-226734590 CACTCCCACCCAGGGAGCTTAGG + Exonic
947232189 2:227899788-227899810 CACACCCACCCCTGGAACTTAGG + Intronic
947544501 2:231001370-231001392 CACCCCCACCCCAGGAACTGAGG + Intronic
948075205 2:235160550-235160572 CTCTCCCTCCGGAGGCTCTTGGG + Intergenic
1172519322 20:35556959-35556981 CCCTCCCACCCCAGGTACTGAGG + Exonic
1173725244 20:45293029-45293051 CACTCCCACCCCATCCATTTAGG + Intergenic
1174390573 20:50216250-50216272 CACTCCCACCCCACGCCCCTGGG + Intergenic
1175630770 20:60534629-60534651 CACTCCTACCAGAGGCTCTAAGG - Intergenic
1176266661 20:64212822-64212844 CACGGCCACCCATGGCACTTAGG - Intronic
1177254614 21:18644978-18645000 CACTCCCACTGGAGGCTCTAGGG + Intergenic
1178878954 21:36433555-36433577 CCCACCCATCCGTGGCACTTGGG + Intergenic
1181171950 22:21014917-21014939 CACTCCCACCCCAGGAAGTGAGG + Intronic
1181177352 22:21045277-21045299 CACTCCCACCGGAGGAAGTGAGG - Intergenic
1182582891 22:31325715-31325737 CACTCCCACCCCAGGTGCTGGGG + Intergenic
1183149605 22:36027917-36027939 CACTCCACCCCAAGGCACTAAGG + Intronic
1184472803 22:44705188-44705210 CGCTCCCACCAGAGGCTCTAGGG + Intronic
1184734260 22:46388827-46388849 CACTCCCACCCGCAGCTCTGAGG - Intronic
950479708 3:13236846-13236868 CACCCCCACCCAGGGTACTTTGG + Intergenic
953120821 3:40039871-40039893 CACTCCCTCCCAAGTCTCTTGGG + Intronic
954862651 3:53703537-53703559 CACTCTGACCCGAGGCACAAAGG - Intronic
959630395 3:108500963-108500985 CACTCCCTCTGGAGGCTCTTGGG - Intronic
961365678 3:126397945-126397967 CACTCCCACCTCAGGGCCTTTGG - Intronic
961915400 3:130368953-130368975 CACTCCCACCTGAGGATCTGAGG - Intronic
970017629 4:11530615-11530637 CACTCCCTCCGGAGGCTCTAGGG + Intergenic
975095282 4:70450227-70450249 CACTGCCACCCCAGGCACAAGGG + Intronic
980002037 4:127500966-127500988 GACACCCTCCCGAGGTACTTTGG + Intergenic
983945108 4:173577611-173577633 CACTCAGAGGCGAGGCACTTTGG - Intergenic
985607947 5:868713-868735 CACTCCCAGCAGAGGCACATGGG - Intronic
985994135 5:3587279-3587301 CACTCCCAGCCAAGGCACACAGG + Intergenic
988143068 5:27267451-27267473 CACTGCCACCCCAGGCAGTGAGG - Intergenic
997025485 5:130055722-130055744 CACTGCCACCGGAAGCACTGTGG + Intronic
1000036061 5:157448890-157448912 CACTCCCACCTCAGGGCCTTTGG + Intronic
1000595402 5:163209815-163209837 CCCTCCTACCCGAGGCAATTAGG - Intergenic
1001406536 5:171481024-171481046 CACCCCGACCCGAGTCTCTTCGG - Intergenic
1001594690 5:172890740-172890762 CTCTCCCACACCAGGCACTAGGG - Intronic
1001706358 5:173743907-173743929 GACTCCCACGCGGGGCAGTTCGG - Intergenic
1001839919 5:174866577-174866599 TACTCTAACCCGAGGCATTTTGG + Intergenic
1002289917 5:178193454-178193476 CACTTCCCCCCGAGGCAAATCGG - Intergenic
1006854465 6:37123543-37123565 CACTCCAAAGCGTGGCACTTTGG + Intergenic
1011163408 6:84418746-84418768 CACTCCCTCCAGAGGCTCTCAGG + Intergenic
1011326184 6:86151670-86151692 CCCTCCCAGCTCAGGCACTTAGG - Intergenic
1015383665 6:132598548-132598570 CACTCACATCCTAGGAACTTGGG + Intergenic
1015791791 6:136970908-136970930 CACCCCCAACAGAGGGACTTTGG + Intergenic
1018395493 6:163375175-163375197 CACTCCCACACAAGGCGCTCTGG - Intergenic
1019578137 7:1747325-1747347 CACACACACACGAGGGACTTCGG + Exonic
1019859384 7:3643484-3643506 CACTCCCACCTGAGCAACTGTGG + Intronic
1022128159 7:27378024-27378046 CACCTCCACCCAAGGCACTTGGG + Intergenic
1023924319 7:44654620-44654642 CCCGCCCTCCCGAGTCACTTAGG - Intronic
1024924680 7:54600423-54600445 CAGTCACATCAGAGGCACTTGGG + Intergenic
1026975455 7:74495166-74495188 CTCTCCCACCCCAGACACCTGGG - Intronic
1028292566 7:89084426-89084448 AACTCTCACCCCAGGCACATTGG + Intronic
1032428754 7:131843467-131843489 CACTCCCTCCCGAGTGACCTTGG + Intergenic
1032564824 7:132930638-132930660 CAATTCCACCAGAGGCAGTTTGG + Intronic
1033498943 7:141928187-141928209 CACTCCCACCCCAGGCCATTGGG + Exonic
1035476734 7:159149227-159149249 CCCTCCCACCCCAGGCAGGTGGG + Intergenic
1037768114 8:21784122-21784144 CCCTCCCTCCTGAGGCACTGTGG - Intronic
1037947139 8:22996684-22996706 CCCTCCCACCCCAGGCCCTGAGG - Intronic
1038055974 8:23858054-23858076 CCCTCCCACCCACTGCACTTGGG - Intergenic
1050073113 9:1837244-1837266 GACACCCACCACAGGCACTTTGG - Intergenic
1050547954 9:6724964-6724986 CACTCCCTCCAGAGGCTCTGGGG + Intronic
1056996165 9:91461543-91461565 CACTCCCTCCGGAGGCTCTTGGG + Intergenic
1057967455 9:99517967-99517989 CACTCCCTCCAGAGGCTCTAGGG - Intergenic
1058453023 9:105114494-105114516 AAGTCCCACCAGAGGCACTGAGG + Intergenic
1058767850 9:108199076-108199098 CACTGCCACCCGAGGCTGTGAGG - Intergenic
1058780210 9:108325569-108325591 CACTCCCACCTGAGGCCATGAGG - Intergenic
1061876712 9:133547719-133547741 CACCCCCTCCCCAGGCACTATGG + Intronic
1061884517 9:133584899-133584921 CACTGCCAGCCAAGGCAATTTGG + Intronic
1061955630 9:133959869-133959891 CCCTCCCTCCAGAGGCACTAGGG - Intronic
1187235998 X:17468009-17468031 CACTGCCACCCCAGGGATTTGGG + Intronic
1192667300 X:73101483-73101505 CACTACCACCCCAGGCCCTGAGG + Intergenic
1195324265 X:103745362-103745384 CACTCTCACCTGAGCCCCTTTGG + Intergenic
1198774176 X:140162055-140162077 CACTTGCACCCTAGTCACTTAGG + Intergenic
1199164988 X:144661473-144661495 CACTCCCACAAAATGCACTTTGG - Intergenic
1199287966 X:146074792-146074814 TGGTCCCACCCGTGGCACTTAGG + Intergenic
1200041660 X:153375312-153375334 CACTCCCCCCAGAGGCTCTAGGG - Intergenic