ID: 1090977942

View in Genome Browser
Species Human (GRCh38)
Location 11:131691964-131691986
Sequence CCCGCAGTCCCATCCAGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 161}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090977942_1090977950 1 Left 1090977942 11:131691964-131691986 CCCCTCCTGGATGGGACTGCGGG 0: 1
1: 0
2: 0
3: 18
4: 161
Right 1090977950 11:131691988-131692010 AGGCGTGGGAACTGTCATCAAGG 0: 1
1: 0
2: 1
3: 5
4: 101
1090977942_1090977952 21 Left 1090977942 11:131691964-131691986 CCCCTCCTGGATGGGACTGCGGG 0: 1
1: 0
2: 0
3: 18
4: 161
Right 1090977952 11:131692008-131692030 AGGCATCCCACATGGCCCCTAGG 0: 1
1: 0
2: 0
3: 17
4: 170
1090977942_1090977951 13 Left 1090977942 11:131691964-131691986 CCCCTCCTGGATGGGACTGCGGG 0: 1
1: 0
2: 0
3: 18
4: 161
Right 1090977951 11:131692000-131692022 TGTCATCAAGGCATCCCACATGG 0: 1
1: 0
2: 0
3: 9
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090977942 Original CRISPR CCCGCAGTCCCATCCAGGAG GGG (reversed) Intronic
900095546 1:938655-938677 CCCTCACTCCTGTCCAGGAGGGG + Intronic
900953529 1:5873152-5873174 CCAGCCCTCCCCTCCAGGAGGGG + Intronic
901047350 1:6405212-6405234 CCCGCAGCCCCACCCAGCAGAGG + Intergenic
901625735 1:10623922-10623944 GCCACATTCACATCCAGGAGTGG - Intronic
902219417 1:14955441-14955463 CCCCCAGACTCTTCCAGGAGTGG - Intronic
907950273 1:59176599-59176621 CCTGTAGTCCCATCAATGAGGGG - Intergenic
908457603 1:64319540-64319562 CCCAGAGTCCCTTCCAGCAGGGG + Intergenic
912800313 1:112715772-112715794 CCAGCAGCCCCATCCAGAGGTGG - Intergenic
912856199 1:113170736-113170758 CCTGCAGTCCCAGCCATGCGTGG + Intergenic
913190003 1:116405496-116405518 CCCTCAGTCTCAGCCATGAGTGG + Intronic
913968070 1:143393250-143393272 CAGGCAGTCCCATCCAGGACTGG - Intergenic
914062451 1:144218840-144218862 CAGGCAGTCCCATCCAGGACTGG - Intergenic
914116699 1:144747514-144747536 CAGGCAGTCCCATCCAGGACTGG + Intergenic
915996929 1:160572955-160572977 GCCCCAGCCCAATCCAGGAGGGG - Intronic
918310560 1:183282425-183282447 CAAGGAGTCCCCTCCAGGAGAGG - Intronic
918437116 1:184526896-184526918 CCCGCAGTCCCGTCCTTAAGGGG + Intronic
920167213 1:204044451-204044473 CAAGCAGTCCCAACCAGGTGTGG - Intergenic
922462497 1:225824154-225824176 CCCGCAGTCCTTCCCAGGACTGG + Intronic
1063091478 10:2869222-2869244 CCTAGAGTCCCATCCAGGACTGG + Intergenic
1065468302 10:26049303-26049325 CAGGCAGTCCTAGCCAGGAGAGG + Intronic
1069749591 10:70736758-70736780 CACTCAGTCCCATCCAGCGGGGG - Exonic
1070724505 10:78778966-78778988 CCCGCAAATCCATCCAGGAATGG + Intergenic
1071151796 10:82644245-82644267 CCAGCAGTCACATGCAGGAATGG + Intronic
1071297707 10:84234187-84234209 CCCAGAGCTCCATCCAGGAGTGG - Exonic
1081550565 11:44107930-44107952 CCGACAGTCCCATCCCAGAGCGG + Exonic
1084045583 11:66566055-66566077 CCTCCAGTCCCATTCAGGTGGGG + Exonic
1084732453 11:71082174-71082196 TCCACAGTGCCAGCCAGGAGTGG - Intronic
1090977942 11:131691964-131691986 CCCGCAGTCCCATCCAGGAGGGG - Intronic
1091917275 12:4278743-4278765 CCTGCCTTCCCCTCCAGGAGTGG + Exonic
1095467586 12:42504234-42504256 CCAGGACTCACATCCAGGAGTGG - Intronic
1097161280 12:57048298-57048320 CCCACAGAACCTTCCAGGAGAGG + Exonic
1101443147 12:104718591-104718613 CCTGCAGTCCCTTTGAGGAGTGG + Intronic
1104957230 12:132472844-132472866 CCCGGTGTCCCCTCCTGGAGAGG + Intergenic
1104957253 12:132472925-132472947 CCCGGTGTCCCCTCCTGGAGAGG + Intergenic
1104957265 12:132472966-132472988 CCCGGTGTCCCCTCCTGGAGAGG + Intergenic
1104957276 12:132473007-132473029 CCCGGTGTCCCCTCCTGGAGAGG + Intergenic
1104957289 12:132473048-132473070 CCCGGGGTCCCTTCCTGGAGAGG + Intergenic
1104957361 12:132473290-132473312 CCCGGGGTCCCTTCCTGGAGAGG + Intergenic
1104957372 12:132473331-132473353 CCCGGTGTCCCCTCCTGGAGAGG + Intergenic
1104957385 12:132473372-132473394 CCCGGGGTCCCTTCCTGGAGAGG + Intergenic
1104957410 12:132473453-132473475 CCCGGGGTCCCTTCCTGGAGAGG + Intergenic
1104957422 12:132473494-132473516 CCCGGGGTCCCTTCCTGGAGAGG + Intergenic
1104957457 12:132473615-132473637 CCCGGGGTCCCTTCCTGGAGAGG + Intergenic
1104957469 12:132473656-132473678 CCCGGGGTCCCCTCCTGGAGAGG + Intergenic
1104957482 12:132473697-132473719 CCCGGGGTCCCTTCCTGGAGAGG + Intergenic
1104957494 12:132473738-132473760 CCCGGGGTCCCTTCCTGGAGAGG + Intergenic
1104957552 12:132473939-132473961 CCCGGTGTCCCCTCCTGGAGAGG + Intergenic
1104957576 12:132474021-132474043 CCCGGTGTCCCCTCCTGGAGAGG + Intergenic
1104957587 12:132474062-132474084 CCCGGTGTCCCCTCCTGGAGAGG + Intergenic
1104957599 12:132474103-132474125 CCCGGTGTCCCCTCCTGGAGAGG + Intergenic
1111924208 13:94445833-94445855 CCCGCTGCCCCATGCAGAAGTGG + Intronic
1114199225 14:20506414-20506436 CCAGCCGTCCCGTCCGGGAGGGG + Intronic
1116254545 14:42534480-42534502 CCTGTAGTCCCAGCTAGGAGAGG + Intergenic
1117602694 14:57391031-57391053 CCCGCTGTCCCTTCCCGGCGGGG + Exonic
1120057793 14:79946020-79946042 CCAGCAGCCCCATCCCAGAGAGG + Intergenic
1120128227 14:80772650-80772672 CCCACAGTAGCATCCAGGCGTGG - Intronic
1122716872 14:103701217-103701239 TCGGCAGTCCCATCCTGGAGCGG - Intronic
1122810512 14:104285407-104285429 CCCCCAGTCCTACCCAGGAGGGG - Intergenic
1123476099 15:20593399-20593421 CCCCCTGTCTCCTCCAGGAGAGG + Intergenic
1123641913 15:22406965-22406987 CCCCCTGTCTCCTCCAGGAGAGG - Intergenic
1124990556 15:34669405-34669427 CCTGCAGTCCCAGCTATGAGAGG + Intergenic
1127325937 15:57895600-57895622 GCATCAGTCCCATACAGGAGAGG - Intergenic
1130856730 15:87845856-87845878 TGAGCAGTCCCATCAAGGAGTGG - Intergenic
1133125214 16:3641911-3641933 CCAGCCGTCCCACCCAGGAAAGG + Intronic
1135398214 16:22147334-22147356 CACCAAGTCCCCTCCAGGAGAGG + Intronic
1137232001 16:46575018-46575040 CCCACAGTGCCATCCAGCAGGGG + Intergenic
1137552885 16:49452728-49452750 GTAGCAGTCCCAGCCAGGAGGGG - Intergenic
1139431010 16:66911061-66911083 CCCCCAGCCCCAAGCAGGAGAGG - Intronic
1140017468 16:71201468-71201490 CCCTCACTCCAATCCAGGAGTGG + Intronic
1141112244 16:81279395-81279417 CCCGTAGTCACCTCCAGTAGTGG + Intronic
1141622223 16:85242361-85242383 CCCGCACCCCCATGCAGGAAGGG + Intergenic
1142371092 16:89682729-89682751 CCTGCAGCCCCACCCAGAAGCGG - Exonic
1144627077 17:16849496-16849518 CCCACAGCTCCATACAGGAGGGG - Intergenic
1144879364 17:18423216-18423238 CCCACAGCTCCATACAGGAGGGG + Intergenic
1145152876 17:20521171-20521193 CCCACAGCTCCATACAGGAGGGG - Intergenic
1145749253 17:27343428-27343450 CCTGACATCCCATCCAGGAGTGG - Intergenic
1147134955 17:38429050-38429072 CCCGCAGTCCGACCCGGCAGGGG - Intronic
1147292625 17:39456203-39456225 CCTGTAATCCCAGCCAGGAGAGG + Intergenic
1147581216 17:41628181-41628203 CCCACAGCCCCATACAGGAGGGG - Intergenic
1148644288 17:49210452-49210474 CCCCCAATCCCACCCAGCAGAGG - Exonic
1148755773 17:49972258-49972280 ACCGCAGCGCGATCCAGGAGTGG + Intronic
1151491014 17:74432391-74432413 CCCGCCATCCCAGCCAGGACCGG + Intronic
1151985843 17:77542969-77542991 CCCGCAGCCCCATGCAGGCTGGG + Intergenic
1152022580 17:77788428-77788450 GCCACTGTCCCATCCAGGTGGGG + Intergenic
1153642964 18:7171586-7171608 CCCCCAGACACATCCAGGAGAGG - Intergenic
1153967534 18:10195303-10195325 CCCGCAGTCCCAGCCATGCTTGG + Intergenic
1153985027 18:10343930-10343952 CCCGCCGGCCCCTCCAGCAGGGG - Intergenic
1154341809 18:13509362-13509384 CCCTCAGAGTCATCCAGGAGGGG - Intronic
1155394945 18:25377195-25377217 CCCACAGTAGCATCTAGGAGTGG - Intergenic
1156391264 18:36652670-36652692 CCTGCAGTGCCAACCAGAAGCGG - Exonic
1160473864 18:79165763-79165785 GCTGCAGCCCCACCCAGGAGGGG + Intronic
1160692880 19:467874-467896 ACCCCAGTCCCATCTCGGAGGGG + Intronic
1162079746 19:8210780-8210802 CCAGCAGGCCCAGCCAGGCGTGG + Exonic
1163102502 19:15107094-15107116 CCCAGAGTCCCATCCAGGGAGGG + Intergenic
1163323778 19:16590044-16590066 TCCTCAGTCCCATCCAGGGCAGG - Intronic
1164066680 19:21721711-21721733 CCAGCCGCCCCGTCCAGGAGGGG + Intergenic
1164672752 19:30082322-30082344 CTCACAGTCCCCACCAGGAGGGG + Intergenic
1165423599 19:35733756-35733778 CTCGCAGGCCCCTCCAGGAACGG + Exonic
1166804039 19:45474200-45474222 CCCTCACTCCCTTCCTGGAGAGG - Exonic
1167743738 19:51339448-51339470 CTCGGAGTGCAATCCAGGAGGGG - Intronic
1168235852 19:55062831-55062853 CCCGCAGTGCCCGCCCGGAGTGG - Intronic
1202701858 1_KI270712v1_random:170718-170740 CAGGCAGTCCCATCCAGGACTGG - Intergenic
928343664 2:30469732-30469754 CCTGTAGTCCCAGCCAGGTGTGG - Intronic
932336293 2:70933091-70933113 CCGGCAGGCAGATCCAGGAGCGG - Exonic
934172769 2:89554165-89554187 CAGGCAGTCCCATCCAGGACTGG - Intergenic
934283083 2:91628517-91628539 CAGGCAGTCCCATCCAGGACTGG - Intergenic
934589049 2:95529963-95529985 CACGCATTCACATCCATGAGAGG - Intergenic
938691838 2:133799279-133799301 CCCCCAGTCCAACCTAGGAGTGG - Intergenic
943749152 2:191493846-191493868 CCCACAGTAGCATCTAGGAGTGG + Intergenic
946376388 2:219312395-219312417 CCTGTAGTCCCAGCCAGGTGTGG + Intergenic
947877714 2:233478880-233478902 CACGCTGGCCCATCTAGGAGAGG + Intronic
948118980 2:235514765-235514787 CCCGGTGTCTCATCCAGGACTGG + Intronic
948949080 2:241237192-241237214 CACGCAGCCCCACCCAGGAGAGG + Intronic
949046369 2:241874349-241874371 CCGGCTGTCCCAGCCAGGTGGGG + Intergenic
1168968195 20:1912920-1912942 CCGGGAGGCCCATCCAGGCGGGG - Intronic
1171032697 20:21691613-21691635 GCCGGAGTCACAGCCAGGAGAGG + Intergenic
1171157886 20:22893237-22893259 ACCACAGTCACATTCAGGAGTGG + Intergenic
1172531052 20:35631682-35631704 CCAGCACACCCATCCAGGTGAGG - Exonic
1173427532 20:42955982-42956004 AGCGCATTCCCTTCCAGGAGAGG + Intronic
1175395698 20:58659581-58659603 CCATCAGTCCCATCCAGTTGGGG - Intronic
1176131040 20:63496965-63496987 CCCACAGGCCCTCCCAGGAGTGG + Intronic
1178288171 21:31343602-31343624 CCAGAACTCCCATCCAGGTGCGG + Intronic
1178896340 21:36561720-36561742 CCCTGAGTCTCAGCCAGGAGAGG + Intronic
1178918798 21:36724567-36724589 ACCCAAGTCCCATCCAGGCGCGG - Intronic
1179922565 21:44515036-44515058 CCCGCAGACCCCTCCAGAAAGGG + Intronic
1179961072 21:44767182-44767204 CCCGCGGTCCCCTCCAGGGCAGG + Intergenic
1181639243 22:24188119-24188141 CCCGAAGTGCCAGCCAGGTGAGG + Exonic
1185070344 22:48652564-48652586 CACCCAGCGCCATCCAGGAGGGG + Intronic
1185102056 22:48845819-48845841 CCTGGAGTCCGATCCAGGTGAGG + Intronic
1185250478 22:49799224-49799246 CCTGCAGGCCCATCCTGGGGAGG + Intronic
949559665 3:5189214-5189236 CCTCCACTCCCATCCAGGGGAGG - Intronic
949866997 3:8554666-8554688 CCATCAGTTCCATCCAGGTGGGG - Intronic
951901174 3:27659006-27659028 CTCCCAGTCCCATCCAGGGAGGG - Intergenic
954716349 3:52528778-52528800 CCCTCCGTCCCATCCAGCTGGGG - Intronic
956653895 3:71530875-71530897 CCCCCAACCCCATCCAGGAATGG + Intronic
963167989 3:142224991-142225013 ACCTCAGTCCCATCCAGGTAAGG + Intronic
969110119 4:4839280-4839302 GCCACAGTCTCAGCCAGGAGAGG + Intergenic
969581726 4:8069206-8069228 CCCGGCGTCCCCTCCAGCAGTGG + Intronic
971691128 4:29837809-29837831 CCCCTAATCCCATCCAGAAGAGG + Intergenic
973094197 4:46176646-46176668 CCCTCACTCCCAGCCAGGGGAGG + Intergenic
984339490 4:178437587-178437609 CCAGCAGTCACAGACAGGAGTGG - Intergenic
984804021 4:183736473-183736495 CCAGCCGCCCCATCCGGGAGGGG - Intergenic
992463680 5:76984860-76984882 CCAGCCGCCCCATCCGGGAGGGG - Intergenic
995281272 5:110338456-110338478 CCTGCGATCCCATCCAGGAACGG - Intronic
997439787 5:133901091-133901113 CCAGCAGGCCCTTCCAGGACAGG + Intergenic
998718836 5:144918810-144918832 CCCTCAGTCCCATCAATGTGGGG - Intergenic
1002013688 5:176305118-176305140 CCAGCCGTGCCATCCAGGAGGGG + Intronic
1002189841 5:177472740-177472762 CCCGCAGTCCCCTTCAGGTAGGG + Intronic
1005990287 6:30898011-30898033 CGCAGATTCCCATCCAGGAGAGG - Intronic
1007401318 6:41604206-41604228 CCCTCTGTCCTAGCCAGGAGGGG + Intergenic
1007781557 6:44257480-44257502 CCCGCCGCCGCCTCCAGGAGCGG + Exonic
1018860447 6:167707285-167707307 CCCGCATGTCCATCCAGGAAAGG + Intergenic
1019513260 7:1429002-1429024 CCTGCAGACCCCGCCAGGAGGGG - Intronic
1019597366 7:1864337-1864359 CCCCGAGTCCCGTCCAGGAAAGG - Intronic
1022056533 7:26741393-26741415 CCTGCAGTCCCAGCCAGTGGAGG + Intronic
1024973575 7:55092775-55092797 CCCGCTGGCCCTGCCAGGAGCGG - Intronic
1026735784 7:72947845-72947867 CCCTCAGTCACATCGGGGAGGGG - Intronic
1026786127 7:73302776-73302798 CCCTCAGTCACATCGGGGAGGGG - Intronic
1026787784 7:73312877-73312899 CCCACAGGCCCATCCCGGCGGGG - Exonic
1029437087 7:100569466-100569488 ACCCCCTTCCCATCCAGGAGTGG - Intergenic
1032279042 7:130486438-130486460 CTCGCAGCCCGCTCCAGGAGTGG + Intronic
1035242663 7:157542460-157542482 CCCGCAGCCCCATCATGCAGTGG + Intronic
1035370392 7:158376105-158376127 CCTGCAGTAGCATCCAGGGGTGG - Intronic
1036382240 8:8244149-8244171 CCCGCGGCCCCATCCAGAAGTGG + Intergenic
1037547613 8:19939676-19939698 CCCGGAGTGGGATCCAGGAGGGG + Intronic
1045470339 8:102506788-102506810 GCCCAAGTCCCATCCATGAGAGG + Intergenic
1049249207 8:141579152-141579174 TCCACAGTCCCTTCCAAGAGTGG - Intergenic
1050343264 9:4662279-4662301 TCCGCACTACCATCCCGGAGGGG - Intronic
1051270909 9:15354094-15354116 TCTGCAATCCCATCCAGGAACGG + Intergenic
1056126135 9:83537976-83537998 CCCCCAATCCCCTCCGGGAGTGG + Intronic
1057702382 9:97373143-97373165 CTCTCAGTCCCACCCAGCAGAGG - Intronic
1057941570 9:99289625-99289647 CTCTCAGCCCCATCCTGGAGGGG + Intergenic
1057992400 9:99783988-99784010 TCTGCAATCCCATCCAGGAATGG + Intergenic
1058501519 9:105623623-105623645 ACCACACTCCCATCCAGGTGTGG + Intronic
1061158416 9:128879339-128879361 CTGGCAGTGCCATCCAGGAGTGG + Intronic
1061835081 9:133323422-133323444 CCAGCAGTCCCATTCAGGCTAGG - Intergenic
1061854156 9:133432657-133432679 CATTCTGTCCCATCCAGGAGAGG - Exonic
1186638064 X:11427480-11427502 CTCGCAGTCCCCACCCGGAGCGG + Intronic
1189968193 X:46395252-46395274 CCAGCCGCCCCATCCGGGAGGGG - Intergenic
1199699009 X:150363058-150363080 CCCGCTGCCCCATCCCGGAGTGG + Intronic