ID: 1090978391

View in Genome Browser
Species Human (GRCh38)
Location 11:131695037-131695059
Sequence CGCCGCCGCCGGGAGGGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 390
Summary {0: 1, 1: 1, 2: 4, 3: 35, 4: 349}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090978382_1090978391 12 Left 1090978382 11:131695002-131695024 CCAGAGGGCAGTGTTGGACGGGC 0: 1
1: 0
2: 0
3: 4
4: 86
Right 1090978391 11:131695037-131695059 CGCCGCCGCCGGGAGGGTGCAGG 0: 1
1: 1
2: 4
3: 35
4: 349
1090978379_1090978391 15 Left 1090978379 11:131694999-131695021 CCACCAGAGGGCAGTGTTGGACG 0: 1
1: 0
2: 1
3: 18
4: 139
Right 1090978391 11:131695037-131695059 CGCCGCCGCCGGGAGGGTGCAGG 0: 1
1: 1
2: 4
3: 35
4: 349
1090978377_1090978391 22 Left 1090978377 11:131694992-131695014 CCTGCTGCCACCAGAGGGCAGTG 0: 1
1: 1
2: 7
3: 57
4: 357
Right 1090978391 11:131695037-131695059 CGCCGCCGCCGGGAGGGTGCAGG 0: 1
1: 1
2: 4
3: 35
4: 349

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090978391 Original CRISPR CGCCGCCGCCGGGAGGGTGC AGG Intronic
900180124 1:1307648-1307670 CGCGGCCGCCGGGGAGGGGCTGG - Intronic
900195480 1:1373576-1373598 GGCCGCCGTCCAGAGGGTGCTGG - Intergenic
900955257 1:5882808-5882830 AGCCTCCACTGGGAGGGTGCAGG - Intronic
901109607 1:6784845-6784867 CGCCGCTGCCGGTGGGGAGCCGG - Intergenic
901271141 1:7953236-7953258 CGCCCCGTCCGGGAGGGTGGTGG + Intergenic
901341833 1:8502316-8502338 CGCCCCGTCCGGGAGGGTGGTGG + Intronic
901341884 1:8502443-8502465 CGCCCCGTCCGGGAGGGTGGTGG + Intronic
901797940 1:11691492-11691514 CGCCGCCGCCGCGAGGGCGCGGG - Exonic
902214121 1:14924039-14924061 CGCCGCGGCGGGGCGGGGGCGGG + Intronic
903115535 1:21176309-21176331 CGCCGCCGCCGCTCCGGTGCCGG + Exonic
903153340 1:21428424-21428446 CGCCGCCGCCGGGCGCGCCCAGG - Intergenic
903492903 1:23743306-23743328 CGCGGCCGCCGGGTGGGCGCTGG + Exonic
903597105 1:24503085-24503107 CGCCGCCGCAGGACGGGAGCCGG - Exonic
903628113 1:24745663-24745685 CCCCGCAGCCGGGAGGGAGCCGG - Intronic
903750323 1:25617173-25617195 CTCCGCCGCGGAGAGGGCGCCGG - Intergenic
904039387 1:27575469-27575491 CGCCTCCGCGGCGAGGGTGGTGG - Intronic
904642008 1:31938133-31938155 CGCCGCCGCCGGGCCGGGCCGGG - Exonic
904775134 1:32901554-32901576 CGCCGCCGCCGGTGGGCTGAGGG - Intergenic
904784369 1:32974110-32974132 CGCCCCGTCCGGGAGGGTGGTGG - Intergenic
905369281 1:37474633-37474655 AGGCGCGGCGGGGAGGGTGCGGG + Intronic
906036090 1:42750924-42750946 CGCCCCGTCCGGGAGGGTGGTGG + Intronic
906367513 1:45223204-45223226 CGCCCCGTCCGGGAGGGTGGGGG + Intronic
906761391 1:48382344-48382366 CGCCCCGTCCGGGAGGGTGGTGG - Intronic
907364169 1:53945976-53945998 CGAGGCCGCCGCGAGGGGGCGGG - Intergenic
908131839 1:61082370-61082392 CGCCGCCGCCGCGGGGGGGAGGG - Intronic
908370625 1:63474251-63474273 CGCCCCGTCCGGGAGGGTGGTGG + Intronic
909640834 1:77869581-77869603 CGCCTCGTCCGGGAGGGTGGTGG - Intronic
912355842 1:109053584-109053606 CGCCCCGTCCGGGAGGGTGGTGG + Intergenic
913069583 1:115286622-115286644 CGCCGCTGCCGGGGCGCTGCGGG + Exonic
913305790 1:117429443-117429465 CGCCCCCTCCGGGAGGGAGGTGG - Intronic
913305969 1:117429817-117429839 CGCCCCCTCCGGGAGGGAGGTGG - Intronic
914788034 1:150851221-150851243 CGCCCCATCCGGGAGGGTGGTGG + Intronic
914888168 1:151600780-151600802 CGCCCCGGCCGGGAGGGAGGTGG + Intergenic
915411032 1:155701031-155701053 CGCCCCCTCCGGGAGGGAGGTGG + Intronic
915539755 1:156558351-156558373 CGCCCCGTCCGGGAGGGTGGTGG + Intronic
915539806 1:156558478-156558500 CGCCCCGTCCGGGAGGGTGGTGG + Intronic
917553319 1:176058063-176058085 CGCCCCGGCCGGGAGGGAGGTGG + Intronic
920535618 1:206734703-206734725 CACCGCCTCCTGGAGAGTGCCGG - Intergenic
920660544 1:207910947-207910969 CTTCGCCGCGGGGAGGGTGGAGG - Intronic
921355445 1:214281063-214281085 CGCCCCCGCGGGGAGGGGGACGG - Intergenic
921472658 1:215567523-215567545 CCCGGCCGCCGGGAAGGTGGGGG + Exonic
922693058 1:227710768-227710790 CGCCCCCTCCGGGAGGGAGGTGG - Intergenic
922766411 1:228158708-228158730 GGCCGCCGCAGGGAAGGCGCAGG - Exonic
923711067 1:236387352-236387374 CGCCCCCTCCGGGAGGGAGGTGG + Intronic
1063504013 10:6580170-6580192 CGCCGCCGCCGGGAGGGAGCGGG - Intronic
1064208966 10:13347770-13347792 CGCCGCCGCCGCGCGGGGCCGGG - Intronic
1064354385 10:14604273-14604295 CGCGGGCGCCGGGAGCGAGCTGG - Intronic
1064443047 10:15370864-15370886 CGGCGGCGGCGGGAGGGTCCCGG - Intronic
1064698145 10:17988733-17988755 CGCCGGAGCCAGGAGGGAGCTGG - Intronic
1065055461 10:21837943-21837965 CGCCCCGGCCGGGAGGGAGGTGG + Intronic
1069645307 10:69992716-69992738 CGCCCCGTCCGGGAGGGTGGTGG - Intergenic
1069769448 10:70888251-70888273 CCCCGCCCCCGGAAGGGTCCCGG + Intronic
1071544784 10:86521321-86521343 CGCCTAGGCCGGGAGGGAGCCGG - Intronic
1072013329 10:91323176-91323198 CGCCCCCTCCGGGAGGGAGGTGG - Intergenic
1072180592 10:92976025-92976047 CGCCGCGTCCGGGAGGGAGGTGG + Intronic
1073325572 10:102642670-102642692 CGCCGCCGCCGCGAGGAAGGCGG - Intergenic
1074863981 10:117534692-117534714 CGCCGCCCCCGGCAAGCTGCTGG + Intergenic
1075802641 10:125161997-125162019 CGCCGTCTCCGGAAGGGAGCTGG + Intergenic
1076809288 10:132878403-132878425 GGCCGCTGCAGGGAGAGTGCGGG - Intronic
1076844210 10:133061017-133061039 GGCCCCCGCCGGGAGGGCACAGG - Intergenic
1076850079 10:133088348-133088370 CGCCGCGGCCGGGCTGGGGCGGG + Intronic
1076992102 11:280718-280740 CGCCGCCCCCGGGAGGCTGCAGG + Exonic
1077103748 11:833153-833175 CGCAGGCGCCGGGAGGTTCCGGG + Intronic
1078514299 11:12009215-12009237 CGCTCCCGCCGGGAGGCCGCCGG + Intronic
1078771748 11:14358560-14358582 CGCCGCGCCCGGGAGGAGGCAGG + Intronic
1079122460 11:17695746-17695768 GGCCGCGGCCGTGGGGGTGCTGG + Intergenic
1079163156 11:18012920-18012942 CTCCGCCCCCGGGCCGGTGCAGG - Intronic
1083118947 11:60491809-60491831 CGCCCCCTCCGGGAGGGAGGTGG + Intergenic
1083617966 11:64035779-64035801 CGCCGCCGCCGCGAGGGGAGAGG + Intronic
1087076215 11:94129094-94129116 CGCCGCCGGCGGGGCGGGGCGGG - Exonic
1088462111 11:110093101-110093123 CGCGGCCGCCGCTAGGGCGCGGG - Intergenic
1089198185 11:116707566-116707588 GGCCGCCGCGGGTGGGGTGCGGG - Intergenic
1089499904 11:118925773-118925795 CGCCGCCGCCCGGAGCCAGCCGG - Intronic
1089591612 11:119545870-119545892 GGCTGCTGCAGGGAGGGTGCTGG + Intergenic
1090978391 11:131695037-131695059 CGCCGCCGCCGGGAGGGTGCAGG + Intronic
1092453967 12:8626125-8626147 CGCCCCGTCCGGGAGGGTGGTGG + Intergenic
1095465513 12:42484104-42484126 CGCCGCCCGCGGGCGGGAGCGGG - Intronic
1096134587 12:49188795-49188817 CGCCGCCGCAGTGCGGGTGCAGG - Intronic
1096167296 12:49436408-49436430 CGCCCCCTCCGGGAGGGAGGTGG - Intronic
1097227672 12:57488138-57488160 GGCCGCCGCCGGGAGAGCCCGGG + Exonic
1097929694 12:65170046-65170068 CGCCGCCGCCGGCCTGGTCCCGG - Exonic
1098413129 12:70203117-70203139 CGCCCCGTCCGGGAGGGTGGTGG + Intergenic
1098426112 12:70366680-70366702 CGCCGGGGGCGGGAGGGGGCGGG + Exonic
1098465893 12:70784581-70784603 GGCCGCTGCAGGGAGGGTACTGG - Intronic
1102174676 12:110867135-110867157 CGCCCCCTCCGGGAGGGAGGTGG - Intronic
1103074259 12:117969298-117969320 CGCCGCCCCCGGGAGCAGGCTGG - Intergenic
1103261632 12:119593817-119593839 CGGCGGCGCCGGGAGGGCGGAGG - Exonic
1106735853 13:32586980-32587002 CGGCGGCGGCGGGAGGGCGCGGG - Intronic
1111388618 13:87561823-87561845 CGCCGCGTCCGGGAGGGAGGTGG + Intergenic
1112497098 13:99913895-99913917 CGCCACCCCACGGAGGGTGCAGG + Intergenic
1112504543 13:99968335-99968357 CGCGGCCGCCGGGAGGGGGCAGG + Intronic
1113254850 13:108495734-108495756 AGCCGCCGCCGAGCGGGTGGCGG + Intergenic
1113655888 13:112067685-112067707 GGGCGCCGCCGGGCGAGTGCAGG - Exonic
1115235664 14:31207200-31207222 CCCCGCCGCCGGCAGGGCCCCGG + Exonic
1120905689 14:89619173-89619195 CGCCGACCCCGGGCGGGCGCCGG - Intergenic
1121535733 14:94689659-94689681 CGCCGCCTCGTGGCGGGTGCGGG - Intergenic
1122541413 14:102499695-102499717 AGCTGCCTCCGGGAGGGGGCGGG - Exonic
1122568080 14:102676349-102676371 CGCCCCGTCCGGGAGGGTGGTGG - Intronic
1122650555 14:103224042-103224064 AGCCGCAGCCTGGAGGGTGGGGG - Intergenic
1122905694 14:104800590-104800612 CGCCCCGGCGGGGAGGGCGCGGG - Intronic
1122917323 14:104865189-104865211 CGGCGCGGCCGGGCGGGGGCGGG + Intergenic
1122975366 14:105168667-105168689 CGTCGCCGCCGGGTGGGAGCCGG - Exonic
1123705953 15:22951375-22951397 AGCCCCGGCCGGGTGGGTGCAGG + Intronic
1125541325 15:40471429-40471451 CCTCGCGGCCGGGCGGGTGCAGG - Exonic
1125577172 15:40763940-40763962 GTCCGCCGCCGGGAGGGCGGGGG + Intergenic
1125752065 15:42036176-42036198 GGCCGCAGCAGGGAGGGTGCGGG + Intronic
1126295757 15:47133434-47133456 CGCCCCGTCCGGGAGGGTGGTGG + Intergenic
1126823650 15:52528891-52528913 CGCAGCCGCCGGCAGGGAGCAGG + Exonic
1127084085 15:55408451-55408473 GGCCGCCGCCGGGCGGCTGCGGG + Intronic
1127584725 15:60367669-60367691 CGCCCCGTCCGGGAGGGTGGTGG + Intronic
1128149849 15:65355898-65355920 CTCCGCCGCCGCGAGTGCGCCGG - Intronic
1129240063 15:74245716-74245738 CGCAGCCACAGGGAGGGTGCAGG - Intronic
1129298936 15:74614751-74614773 GGCGGCCGCCGGGGCGGTGCTGG + Intronic
1129387283 15:75202842-75202864 CGGCGCCGCCGGGAGGGGCTTGG + Intronic
1130990947 15:88875249-88875271 CCCCGCCCCCGGGACCGTGCAGG + Exonic
1131827006 15:96330389-96330411 CGCCGCCGCCGAGAGGGGGATGG - Intronic
1132570457 16:641892-641914 GGGCGCCGCGGGGAGGGGGCGGG - Exonic
1132875104 16:2133677-2133699 GGCCGCCGCTGGGAGAGTTCTGG - Intronic
1133973041 16:10580654-10580676 CCCCGCCGCCTAGAGGGTGGAGG - Exonic
1134519883 16:14913713-14913735 GGCCGCCGCTGGGAGAGTTCTGG + Intronic
1134554048 16:15152524-15152546 GGCCGCCGCTGGGAGAGTTCTGG - Intergenic
1134707555 16:16312367-16312389 GGCCGCCGCTGGGAGAGTTCTGG + Intergenic
1134959988 16:18399758-18399780 GGCCGCCGCTGGGAGAGTTCTGG - Intergenic
1137714817 16:50592229-50592251 TGCCGCCGCCTGGGGGCTGCTGG + Intronic
1138651471 16:58463726-58463748 CGCCGCCGACGCGCGGGTGCAGG - Intronic
1139364833 16:66427048-66427070 CGCCGCCGCCGAGGGGGGCCGGG + Intergenic
1139448761 16:67014364-67014386 CGCCCCCGCCTGGAGACTGCTGG - Intergenic
1139528155 16:67528989-67529011 CGGCGCCGCCCGGTGGGTCCGGG + Intronic
1139864704 16:70052304-70052326 CGCCCCGTCCGGGAGGGTGGTGG + Intergenic
1141531407 16:84648929-84648951 CGCCGCCGGCTGGAGCCTGCTGG + Intronic
1142037255 16:87869731-87869753 CGCGGGCGCCGGGAGGGGGGAGG - Intergenic
1142623723 17:1179919-1179941 CGCTGGGGCCGGGAGGGTTCGGG - Intronic
1143010238 17:3862112-3862134 CGCCCCCGCAGGCAGGGGGCTGG - Intronic
1143527265 17:7479699-7479721 CGCCGCCGCCGAGAGGAGGCCGG + Intronic
1144559753 17:16312094-16312116 CGCCCCCTCCGGGAGGGAGGTGG - Intronic
1144764479 17:17725115-17725137 CGCCGGGGCAGGGAGGGGGCTGG + Intronic
1145210688 17:21011120-21011142 CGCCCCCGCCGTGTGGGTGCAGG + Intronic
1145684514 17:26639027-26639049 CGCCCCCTCCGGGAGGGAGGTGG + Intergenic
1145765517 17:27456269-27456291 CGCGGCCGCCGGGAGGGGAGGGG + Intergenic
1146057640 17:29589266-29589288 GGCCGCCGCCGGGCGGGCGCCGG - Intronic
1146215857 17:30979247-30979269 CGCCCCGTCCGGGAGGGTGGGGG - Intronic
1146444019 17:32921919-32921941 CGCCCCGTCCGGGAGGGTGGTGG - Intergenic
1147141950 17:38465125-38465147 TGCCGCCGCCGTGATGATGCCGG + Intronic
1147705278 17:42421748-42421770 CGCAGCCGGCGGGAGGAGGCTGG - Intronic
1148386583 17:47238616-47238638 CGCGGCTGCGGGGAGGGTGTGGG - Intergenic
1148607993 17:48944709-48944731 CACCGCCGCGGGGTGGGAGCTGG - Exonic
1149296283 17:55265044-55265066 CGCCGGCGCGGGGAGGGGGGTGG + Exonic
1150484867 17:65536828-65536850 CGCCGCGGCCGCGAGGGTCATGG - Intronic
1151498860 17:74476012-74476034 AGGTGCCGCAGGGAGGGTGCAGG - Intronic
1152521612 17:80859866-80859888 CGCCGCCCACAGGAGGGAGCAGG + Intronic
1152921153 17:83067220-83067242 CGCGGCCTCCGGGAGAGAGCTGG + Intergenic
1154106780 18:11530635-11530657 GGCAGCCAGCGGGAGGGTGCAGG + Intergenic
1155053853 18:22169153-22169175 CACCGCCGCTGGATGGGTGCGGG + Intergenic
1155507820 18:26549153-26549175 CGCGGGCGCCGAGAGGGTGCGGG - Exonic
1156242507 18:35267476-35267498 CGCCGCCGCCGGTAGAGCGAAGG - Exonic
1160514487 18:79470897-79470919 CCCCGCCCCAGGGAGGGTGAAGG - Intronic
1161063728 19:2227620-2227642 CGGCGCCGCCAGGCGTGTGCGGG - Intronic
1161153217 19:2720409-2720431 CTCCACCGCCTGGGGGGTGCGGG + Intronic
1161494913 19:4581471-4581493 CGCGGCCGCCGCGAGTGCGCGGG + Intergenic
1161683166 19:5690589-5690611 CGACGCCGCGGGGTGAGTGCGGG + Exonic
1163121932 19:15223526-15223548 GGCCGCCGGCGGGAGGGAGGCGG - Intergenic
1163158107 19:15449806-15449828 CGGCGCCGCCGGCCAGGTGCCGG + Exonic
1164081528 19:21865387-21865409 CGCCCCCTCCGGGAGGGAGGTGG - Intergenic
1164298389 19:23937097-23937119 CGCCCCGGCCGGGAGGGAGGTGG - Intronic
1164602036 19:29568647-29568669 GGCCGCTGCCTGGAGGGCGCAGG - Intergenic
1165157297 19:33796315-33796337 CACCGCTCCCGGGAGGGTCCTGG + Intronic
1166030122 19:40118796-40118818 CGCCCCCTCCGGGAGGGAGGTGG + Intergenic
1166162491 19:40965151-40965173 CGCCCCGTCCGGGAGGGTGGTGG - Intergenic
1166191630 19:41180360-41180382 CGCCCCGGCCGGGAGGGAGGTGG + Intergenic
1166897892 19:46035685-46035707 GGCCACTGCAGGGAGGGTGCAGG + Intergenic
1167557171 19:50203686-50203708 CGCCGCCCCCGGAGGGCTGCCGG - Intronic
1167924684 19:52812121-52812143 CGCCCCGTCCGGGAGGGTGGTGG + Intronic
1167970534 19:53186587-53186609 CGCCCCGTCCGGGAGGGTGGTGG - Intronic
1168149010 19:54435115-54435137 TGCCGCTGCCGGGAGGGAGAAGG + Intronic
925407507 2:3615814-3615836 CGCCGCGTCCGGGAGGGAGGTGG - Intronic
925407527 2:3615860-3615882 CGCCGCGTCCGGGAGGGAGGTGG - Intronic
925922413 2:8646659-8646681 AGCTGCTGCAGGGAGGGTGCAGG + Intergenic
926077159 2:9951174-9951196 CGCCCCCGCCGGGCGAGCGCAGG + Intergenic
927897722 2:26795338-26795360 CGCCCCCTCCGGGAGGGAGGAGG - Intronic
927904286 2:26846531-26846553 CCCCGCCGCCGGGAGGCCGCTGG + Intergenic
928005118 2:27557351-27557373 CGCCCCGTCCGGGAGGGTGGTGG - Intronic
928093422 2:28390448-28390470 AGGCGCCGCCGGGAGCGCGCGGG - Intergenic
929739947 2:44589240-44589262 CGCCCCGTCCGGGAGGGTGGTGG + Intronic
930008424 2:46915876-46915898 CGCCGCCAGCGGGAGGGGCCCGG - Intronic
932345883 2:70994884-70994906 CGCCGCCGCCGAGAGGAGCCCGG + Exonic
933658074 2:84905575-84905597 CGCCGCAGCAGGGGCGGTGCTGG - Intronic
933666816 2:84971141-84971163 CGCCGCTGCCGGGAGCCGGCAGG + Exonic
935592778 2:104856383-104856405 CGCCGCCGCCGCCGTGGTGCGGG - Exonic
938058334 2:128233385-128233407 CGTCGCCGCCGGGAGAGCGAAGG - Intergenic
938088645 2:128418218-128418240 CGCCCCGTCCGGGAGGGTGGGGG - Intergenic
938315931 2:130327967-130327989 CGCCGCCGTCGGGCGCCTGCTGG + Intergenic
938534247 2:132222191-132222213 CGCCCCGTCCGGGAGGGTGGTGG + Intronic
940643755 2:156369484-156369506 CGCCCCGTCCGGGAGGGTGGTGG + Intergenic
940987206 2:160062060-160062082 CGCAGGAGCCAGGAGGGTGCCGG + Intronic
942046149 2:172100575-172100597 CCCCGCCGCCGTGATGGTGGTGG + Exonic
942046557 2:172102439-172102461 CGCCGCCGCTCGGGGGCTGCTGG + Exonic
942151064 2:173076156-173076178 CGCCGCCGCCGGGCGGGCCCTGG - Intronic
942241103 2:173964670-173964692 CGCCGCCGGGGGGCGGGTGGGGG - Intronic
942241107 2:173964673-173964695 CGCCGCCGCCGGGGGGCGGGTGG - Intronic
942241109 2:173964676-173964698 CGCCGCCGCCGCCGGGGGGCGGG - Intronic
942642187 2:178072164-178072186 CCCCGCCACCGGGAAGGGGCTGG + Exonic
943669792 2:190648857-190648879 GGCCGCCGCCGGGCGGGGGCGGG - Intronic
945233278 2:207611375-207611397 CGCCCCGTCCGGGAGGGTGGTGG + Exonic
946322083 2:218960144-218960166 CGCCGCCGTCGGGGGGATCCCGG - Exonic
946395528 2:219442101-219442123 GGGCGGCGCCGGGAGGGGGCAGG + Intronic
947353600 2:229271170-229271192 CACCGCCGCCGGGTGGGCGTAGG + Exonic
947860514 2:233354511-233354533 CGCCGCCGCCGCCATGCTGCCGG - Exonic
948206740 2:236166701-236166723 TGCCGAGGCTGGGAGGGTGCGGG - Intronic
948206931 2:236167458-236167480 CTCCGCGGCCGAGACGGTGCAGG - Exonic
948874702 2:240820360-240820382 GGCCGCCGCGGGGATGGGGCTGG + Intergenic
1168878165 20:1185288-1185310 CGGCGCAGCCCGGAGGGCGCGGG + Intronic
1168883452 20:1226221-1226243 CGCCGGCGCCGGGTGCGTGTGGG - Intronic
1168904591 20:1392986-1393008 CGCCGCCGCCATGGGAGTGCAGG - Exonic
1169370979 20:5028007-5028029 CGCCCCCTCCGGGAGGGAGGTGG + Intergenic
1169557606 20:6767620-6767642 GGCCGCGGCCGGGAGGGAGCCGG + Intergenic
1172051436 20:32121940-32121962 CGCCCCGTCCGGGAGGGAGCTGG - Intronic
1172951100 20:38724072-38724094 CGCCGCCGCAGGGTGGGAGGGGG - Intergenic
1175926846 20:62475434-62475456 AGCCGGCGCCCGGAGCGTGCAGG + Exonic
1175968477 20:62671900-62671922 CGCCGTGGCCGGGTGGGCGCGGG - Exonic
1176026281 20:62987154-62987176 CGTGGCCCCCAGGAGGGTGCAGG - Intergenic
1176194524 20:63831132-63831154 CGCGGCCGCCGGGCCGGCGCCGG + Intronic
1176348382 21:5770897-5770919 CGCCTCCTCCGGGAGGGAGGTGG - Intergenic
1176355196 21:5891481-5891503 CGCCTCCTCCGGGAGGGAGGTGG - Intergenic
1176496445 21:7553558-7553580 CGCCTCCTCCGGGAGGGAGGTGG + Intergenic
1176542703 21:8168967-8168989 CGCCTCCTCCGGGAGGGAGGTGG - Intergenic
1176561654 21:8352012-8352034 CGCCTCCTCCGGGAGGGAGGTGG - Intergenic
1178961895 21:37073255-37073277 AGCCGACGGCGGGAGGGAGCGGG - Intronic
1180190870 21:46161877-46161899 GGGCGCGGCCAGGAGGGTGCGGG - Intronic
1181162886 22:20968115-20968137 CGCTGCCGCCAGGAGGGGGTAGG + Intronic
1181586562 22:23855639-23855661 CGCCCCGTCCGGGAGGGTGGTGG + Intergenic
1183748160 22:39704165-39704187 TGCCCCCGCCAGGAGGGAGCTGG + Intergenic
1184203018 22:42982230-42982252 CGCCCCGTCCGGGAGGGTGGTGG + Intronic
1184228242 22:43143054-43143076 CGCCGCCGCCCGCCGCGTGCTGG - Exonic
1184403657 22:44287840-44287862 GGCTGCAGCAGGGAGGGTGCTGG - Intronic
1184644722 22:45889657-45889679 CGGCCCCGCCGGGAGGGCGAGGG - Intergenic
1184697867 22:46150112-46150134 CGCGGCCGCGGGGCGGGTGGAGG - Intergenic
1184865021 22:47197451-47197473 CGCCCCCGCCCTGTGGGTGCCGG + Intergenic
1185333524 22:50261815-50261837 GGCCGCCGCCGGGGGAGGGCCGG + Exonic
1203247570 22_KI270733v1_random:85210-85232 CGCCTCCTCCGGGAGGGAGGTGG - Intergenic
953598351 3:44338537-44338559 CGCCGGAGCGGGGAGGGTGTTGG + Exonic
954063583 3:48088774-48088796 CGCCGCCGCCGAGACGGAGCTGG + Exonic
954399197 3:50311239-50311261 CGCCCCGGCCGGGAGGGAGTTGG - Intronic
955182278 3:56683265-56683287 CGTCGGGGCCGGGAGGGGGCGGG + Intergenic
958808318 3:98836881-98836903 CGCCCCCTCCGGGAGGGAGGTGG - Intronic
958900097 3:99876084-99876106 CGCCGGGGCCGGGCGGGGGCCGG + Intronic
959063504 3:101636012-101636034 CTCCGCTGCGGGGAGGGTGAGGG - Intergenic
961473966 3:127135667-127135689 AGGGGCCGCGGGGAGGGTGCGGG - Intergenic
961551622 3:127673092-127673114 CGCAGTCCCGGGGAGGGTGCGGG + Intronic
962318812 3:134374693-134374715 CACCGCGGCCTGGAGGGCGCTGG - Intronic
962520748 3:136195853-136195875 CGCCGCCGGCGGGCGGGAGGGGG + Intronic
962572335 3:136723860-136723882 CGCCCCGTCCGGGAGGGTGGTGG + Intronic
963498500 3:146096979-146097001 CGCCCCGGCCGGGAGGGAGGTGG + Intronic
967880327 3:194297184-194297206 CGCCGCCGCCGCCAGCTTGCTGG + Intergenic
968479171 4:826232-826254 CGCGGGCGCCGGGCGGGGGCGGG + Intergenic
968652795 4:1766847-1766869 CGCCGGAGCCAGGAGGGTGAGGG - Intergenic
968903369 4:3441220-3441242 CACCGCCGCCTGGATGGTACAGG - Intergenic
969720953 4:8892878-8892900 CACCGACGCGGGGAGGGGGCAGG - Intergenic
974047275 4:56908360-56908382 CGGCCCCGCCGGGCGGGGGCTGG + Intronic
975986117 4:80202701-80202723 CGCCGCCGCCGCCAGCGTCCTGG - Exonic
976149464 4:82077968-82077990 CGCCCCCTCCGGGAGGGAGGTGG + Intergenic
976265580 4:83185244-83185266 CGCCCCGTCCGGGAGGGTGGTGG - Intergenic
979674563 4:123397869-123397891 TGCCGCGGCCGGGAGGGGGAGGG - Intronic
979832319 4:125317211-125317233 CGCCGCCACCTGGAGGACGCTGG - Exonic
980541441 4:134201532-134201554 CGCCGCCGCCGAGGCGCTGCCGG + Intronic
981429831 4:144645982-144646004 CGCCGCAGCAGGGAGGCCGCCGG + Intergenic
981523980 4:145693673-145693695 CGCCCCCTCCGGGAGGGAGGTGG - Intronic
981782628 4:148444765-148444787 CGCCGCCGCTGGGGGCGGGCGGG - Intergenic
982712211 4:158768951-158768973 CGCCGCCGCCGTGGGGCTGCGGG + Intergenic
984973506 4:185210201-185210223 CGCCGCCGCCTGGAGCCGGCTGG + Intronic
985718868 5:1478542-1478564 GGCAGTGGCCGGGAGGGTGCAGG - Intronic
986608252 5:9544806-9544828 GGCCGCCGCGGGGAGCGAGCCGG + Intronic
987402330 5:17491359-17491381 CGCCTCCGTGGAGAGGGTGCCGG - Intergenic
989587498 5:43087165-43087187 CGCCCCGTCCGGGAGGGTGGTGG - Intronic
990308584 5:54517718-54517740 AGCCGCCGCCGGTCGGGGGCGGG - Intergenic
990557748 5:56952199-56952221 CTCCGCCGCCGGGCGGGTGCCGG - Intronic
992487517 5:77210635-77210657 CGCCGCGGCGGGGAGGGTGGCGG + Intronic
993162778 5:84312392-84312414 CGCCCCGTCCGGGAGGGTGGTGG - Intronic
993162850 5:84312569-84312591 CGCCCCGTCCGGGAGGGTGGTGG - Intronic
996069992 5:119122322-119122344 CGCCCCCTCCGGGAGGGAGGTGG - Intronic
996769733 5:127073504-127073526 GGCCGGCGCCTGGTGGGTGCGGG - Intergenic
996862877 5:128084506-128084528 CGCCGCCGCCGCCGGAGTGCAGG - Exonic
997892400 5:137687394-137687416 CGCCCCGTCCGGGAGGGTGGTGG + Intronic
997892453 5:137687521-137687543 CGCCCCGTCCGGGAGGGTGGGGG + Intronic
1001959564 5:175872020-175872042 CGCCGCAGCCGGGGCGGTCCTGG - Intronic
1002098698 5:176846807-176846829 CGCCGAGGCCCGGAGGGAGCTGG + Intronic
1002193912 5:177492164-177492186 CGCCGGCGGCGGGAGGCAGCAGG + Intronic
1002524364 5:179807031-179807053 CGCCGGCGCCGCGAGGGGGTGGG + Intronic
1003873126 6:10417078-10417100 GGCCGCTGCTGGGAGGGTGTCGG - Intronic
1005063320 6:21796897-21796919 CGCCGCGTCCGGGAGGGAGGTGG - Intergenic
1005606657 6:27484742-27484764 CGCCCCCTCCGGGAGGGAGGTGG - Intergenic
1006064591 6:31454516-31454538 CGCCCCCTCCGGGAGGGAGGTGG - Intergenic
1007686131 6:43668423-43668445 CTGCGCAGGCGGGAGGGTGCTGG - Intronic
1010513290 6:76744804-76744826 CGCCCCCTCCGGGAGGGAGGTGG + Intergenic
1010703259 6:79077610-79077632 TGCCGCCGCCGGCAGGGCGCGGG - Intronic
1012624925 6:101393558-101393580 CGCGGCGGCCAGGAGCGTGCAGG + Intergenic
1013681262 6:112528299-112528321 CGCCCCGGCCGGGAGGGAGGTGG - Intergenic
1013793516 6:113859796-113859818 CGCGGCCGCCGGGAGCGGGGCGG + Exonic
1014800366 6:125771006-125771028 CGCCCCCTCCGGGAGGGAGGTGG + Intergenic
1015773466 6:136791993-136792015 CGCCGCCGCCGGGCAGCTTCTGG - Exonic
1015843857 6:137497812-137497834 CGCCCCAGCCGCGAGGGCGCGGG - Intergenic
1016433137 6:144008419-144008441 CGCGGCCGCGAGGAGGGCGCTGG + Intronic
1017793903 6:157823877-157823899 CGCCCCCGCGGGGCGGGTGGGGG + Intronic
1019142677 6:169957921-169957943 AGTGGCAGCCGGGAGGGTGCAGG - Intergenic
1019458690 7:1146119-1146141 CGCCCCGTCCGGGAGGGTGGTGG - Intergenic
1020224950 7:6272571-6272593 CGCCGCCGGAGGGAGCGCGCAGG + Exonic
1021668616 7:23013493-23013515 CGCCGCGGCAGGGAGGGGACGGG + Intronic
1021735918 7:23638071-23638093 CGCCCCGTCCGGGAGGGTGGTGG + Intronic
1021991901 7:26148275-26148297 CGCCCCCTCCGGGAGGGAGCTGG + Intergenic
1021991924 7:26148322-26148344 CGCCCCCTCCGGGAGGGAGCTGG + Intergenic
1021991947 7:26148369-26148391 CGCCCCCTCCGGGAGGGAGCTGG + Intergenic
1022094543 7:27130538-27130560 CGCCGCCCGCGTGAGGGAGCTGG + Exonic
1022363370 7:29685043-29685065 CGCCGCCGCGGGGAGGTTCCCGG - Intergenic
1022427934 7:30285486-30285508 CGCCGCCGCGGGGAGGTTCCCGG + Exonic
1022698012 7:32728696-32728718 CGCCGCCGCGGGGAGGTTCCCGG + Intergenic
1024247193 7:47479483-47479505 CACCGCCGACGGGGGGGTGGGGG - Intronic
1024579920 7:50793242-50793264 CGCCGCCTCCGCGTGGCTGCGGG + Intronic
1025979134 7:66393369-66393391 CGCCCCGTCCGGGAGGGTGGTGG - Intronic
1026973299 7:74480729-74480751 CGCCGCCGCCGGCAGTATGCGGG - Intronic
1027087517 7:75275083-75275105 CGCCCCCTCCGGGAGGGAGGTGG + Intergenic
1028987667 7:97021113-97021135 CGCCGCCCCGGGGAAGGCGCGGG - Intronic
1029281556 7:99438941-99438963 CGCCGCCGCCCGAGGGATGCCGG - Intronic
1029537394 7:101164454-101164476 CTCCGGCGCCGGGAGGCTGTGGG + Exonic
1029639821 7:101814103-101814125 CGCCGCCTCCCCGAGTGTGCAGG + Intergenic
1029927012 7:104328809-104328831 CGCCGCCGCCGCGATGCTCCCGG + Exonic
1030262422 7:107579988-107580010 CGGCCCCGGCGGGAGGGTGCCGG - Intronic
1030348147 7:108456016-108456038 CGCGGGCGCCGAGAGGGAGCAGG - Intronic
1033165506 7:139035768-139035790 CACCTCCGCCTGGAGGGTGGTGG - Exonic
1034418779 7:150978360-150978382 CGCGGCAGGCGGGAGGGGGCCGG - Intergenic
1034638353 7:152585290-152585312 CGCCCCGTCCGGGAGGGTGGTGG - Intergenic
1034992278 7:155555385-155555407 GGCAGCCGGCAGGAGGGTGCTGG + Intergenic
1035403916 7:158586746-158586768 CGCTGCCCGCGGGGGGGTGCGGG + Intronic
1036096026 8:5725576-5725598 CGCCCCGTCCGGGAGGGTGGTGG + Intergenic
1037947647 8:22999381-22999403 CGACGCCGCGGGGAGGGTCTCGG - Intronic
1038595442 8:28881810-28881832 CGCCCCGTCCGGGAGGGTGGTGG + Intronic
1038744655 8:30246564-30246586 CGCCCCGTCCGGGAGGGTGGTGG - Intergenic
1039875041 8:41578116-41578138 CGCGCCCGACGGGAGCGTGCGGG + Intronic
1040065599 8:43141303-43141325 CGCCGCCGCCTGGGAGGGGCCGG + Intronic
1040069567 8:43179249-43179271 CGCCCCGTCCGGGAGGGTGGTGG - Intronic
1040818989 8:51535073-51535095 CGCCCCGTCCGGGAGGGTGGTGG + Intronic
1041689889 8:60678665-60678687 CGGCGCGGCCCGGAGGGAGCTGG + Intergenic
1043388156 8:79768018-79768040 CACCGCCGCCGGGCAGGGGCGGG - Intergenic
1043388418 8:79768919-79768941 GGCCGCCGGGGGGAGGGGGCGGG - Intergenic
1043873767 8:85463601-85463623 CTCCGCAGCCGGGAGGGGGATGG + Intergenic
1044340443 8:91040862-91040884 TGCCGCCTCCGGGAGGGCCCGGG + Exonic
1044719853 8:95134300-95134322 CGCCGCCGCCGCGGGGGGACGGG + Intronic
1046636881 8:116680181-116680203 CGCCCCTTCCGGGAGGGTGGGGG + Intronic
1046932533 8:119855819-119855841 CGCCGCGCCCGGGTGGCTGCGGG + Exonic
1049660024 8:143815728-143815750 CGCGGCGGCCGGGTGGGTGTCGG - Intergenic
1049697188 8:143990102-143990124 AGCGGCCGCCGAGCGGGTGCGGG + Exonic
1049720093 8:144111707-144111729 CGCTGCTGCCAGGAGGGTGGGGG - Exonic
1049936472 9:505093-505115 GCCGGCCGGCGGGAGGGTGCGGG + Intronic
1050345285 9:4679872-4679894 CGCCGCCGCCTGGCAGCTGCGGG - Exonic
1052858780 9:33423768-33423790 CGCCCCGTCCGGGAGGGTGGTGG + Intergenic
1053203141 9:36166190-36166212 CGCCGCGGGCGGGAGGGAGGGGG - Intergenic
1055090987 9:72364796-72364818 CGCCGCCGCGGGCCGGGAGCGGG + Intronic
1056992498 9:91424210-91424232 CGCGGCGACCGGGAGGGTGAAGG - Intergenic
1057245619 9:93451906-93451928 CGCCGCCGCCATGGGCGTGCAGG + Exonic
1057259655 9:93576640-93576662 CGCCGCGGCCGGGAGGGGACGGG - Exonic
1057463762 9:95292393-95292415 CGTGGCCGCCGGGACGGCGCGGG - Intronic
1058053350 9:100427417-100427439 GGCCGCAGCCGGGCGGGGGCGGG + Intronic
1059633944 9:116154357-116154379 CGCCGCCGCCGGGCGGTGCCTGG + Exonic
1061123111 9:128656465-128656487 CGCGGCTGCCGGGCGGGTTCGGG - Intronic
1061261398 9:129482708-129482730 CGCCGCCGCGGCGTGGGGGCGGG + Intergenic
1061349559 9:130053854-130053876 CGCAGCCGCCGGAAGGGCCCGGG - Exonic
1061365845 9:130172238-130172260 GGCCGCGGCCAGGCGGGTGCGGG + Intergenic
1061472047 9:130834998-130835020 AGCCCCGGCGGGGAGGGTGCAGG - Intronic
1061540657 9:131276639-131276661 CGACCGCGCCGGGCGGGTGCGGG - Intergenic
1061825579 9:133256425-133256447 GGCCGCTGGCGGGCGGGTGCAGG - Intronic
1062022555 9:134326347-134326369 CGGCGCCGGCGGGGGGGTGGCGG - Intronic
1062305774 9:135906717-135906739 CGCCGCCAACGGGAGGCTGGGGG + Intronic
1062333010 9:136052760-136052782 GGCCGCAGCCAGGAGTGTGCGGG - Intronic
1062346722 9:136118485-136118507 CGCCGCCGCGGAGAGGGCACCGG - Exonic
1062537793 9:137028426-137028448 CGCCGCCGCCGGGAAGCCTCCGG + Intronic
1062745921 9:138211990-138212012 CGCCCTGGCAGGGAGGGTGCAGG + Intergenic
1203773375 EBV:60356-60378 CGCCGCCGCCAGGTGGGCCCTGG - Intergenic
1203463976 Un_GL000220v1:68445-68467 CGCCTCCTCCGGGAGGGAGGTGG - Intergenic
1203405762 Un_KI270539v1:783-805 CGCCCCCTCCGGGAGGGAGGTGG + Intergenic
1187507267 X:19887755-19887777 CGCGGCCGCCGGGCGGGGGCGGG + Intergenic
1188003473 X:25002511-25002533 CGCGGCCGAGGGGAGGGTGCAGG - Intergenic
1189308615 X:40005452-40005474 CGCTGCCGCCGGGAAAGTGCCGG + Intergenic
1189322563 X:40095745-40095767 CGCCGGCGTCTGGAGGGTGGGGG - Intronic
1190779406 X:53579303-53579325 CGCCCCGTCCGGGAGGGTGGTGG + Intronic
1191213231 X:57910165-57910187 CGCCGCCGCCGCTAGGTTGATGG + Exonic
1191835433 X:65457421-65457443 CGCCCCGTCCGGGAGGGTGGTGG + Intronic
1192768644 X:74166808-74166830 CGCCCCCTCCGGGAGGGAGGTGG + Intergenic
1196778572 X:119362250-119362272 CGCCCCGTCCGGGAGGGTGGTGG + Intergenic
1197420992 X:126237382-126237404 GGCCACTGCAGGGAGGGTGCAGG + Intergenic
1200100655 X:153687995-153688017 CGCCGCCGCCGGGAAGGAGAGGG + Intronic
1200177344 X:154126235-154126257 CACCGCAGCTGGGAGTGTGCTGG - Intergenic
1200787604 Y:7273902-7273924 CCCCGCGGCCGGGTGGGGGCGGG + Intergenic