ID: 1090978517

View in Genome Browser
Species Human (GRCh38)
Location 11:131695969-131695991
Sequence CTGGAGTGCATGAGAAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 283}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090978516_1090978517 -6 Left 1090978516 11:131695952-131695974 CCGCTCAAAGGACAGGGCTGGAG 0: 1
1: 0
2: 0
3: 36
4: 330
Right 1090978517 11:131695969-131695991 CTGGAGTGCATGAGAAAAACTGG 0: 1
1: 0
2: 1
3: 34
4: 283
1090978509_1090978517 30 Left 1090978509 11:131695916-131695938 CCTGTCCCAAGAGTGACAGCAGC 0: 1
1: 0
2: 2
3: 19
4: 173
Right 1090978517 11:131695969-131695991 CTGGAGTGCATGAGAAAAACTGG 0: 1
1: 0
2: 1
3: 34
4: 283
1090978510_1090978517 25 Left 1090978510 11:131695921-131695943 CCCAAGAGTGACAGCAGCTGCAG 0: 1
1: 0
2: 2
3: 31
4: 274
Right 1090978517 11:131695969-131695991 CTGGAGTGCATGAGAAAAACTGG 0: 1
1: 0
2: 1
3: 34
4: 283
1090978511_1090978517 24 Left 1090978511 11:131695922-131695944 CCAAGAGTGACAGCAGCTGCAGT 0: 1
1: 0
2: 1
3: 39
4: 299
Right 1090978517 11:131695969-131695991 CTGGAGTGCATGAGAAAAACTGG 0: 1
1: 0
2: 1
3: 34
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090978517 Original CRISPR CTGGAGTGCATGAGAAAAAC TGG Intronic
900539090 1:3193861-3193883 CTGGGGAGCATGGGAAATACAGG + Intronic
900545984 1:3229414-3229436 CTTTAGTGCAGGAGAAAGACAGG - Intronic
900710344 1:4109434-4109456 CTGGACTTCATGAGAAAATAGGG + Intergenic
900841102 1:5049276-5049298 CCGAAGTGAAGGAGAAAAACTGG - Intergenic
902720163 1:18298633-18298655 CTGGAGTAAATGAAAAAAAGAGG + Intronic
905060177 1:35133390-35133412 CTGAGGTGAAGGAGAAAAACTGG + Intergenic
906457044 1:46006063-46006085 CTGAAGGGCTGGAGAAAAACAGG + Intronic
906565683 1:46799414-46799436 CTGGAGTGAAGGAGAAATTCCGG - Intronic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
907936272 1:59045117-59045139 CTGGAAAGAATGAGAAAAAGAGG - Intergenic
908845492 1:68320467-68320489 CTGGAGTGAAAGAGAAATACAGG + Intergenic
910049696 1:82959755-82959777 CTGATGTGAAGGAGAAAAACTGG - Intergenic
911699025 1:100928306-100928328 CTGGAGTGTAGGAGAGAAAACGG + Intronic
913014733 1:114721512-114721534 GTGGAAAACATGAGAAAAACAGG + Intronic
913708720 1:121456352-121456374 CTGGAGGGAGGGAGAAAAACGGG + Intergenic
915297502 1:154931560-154931582 CTGCACTGCATGGGAAAGACAGG - Intronic
915699813 1:157781181-157781203 CTGGGTTCCATGAGAACAACAGG + Intergenic
919200631 1:194350981-194351003 CGGGAGTACAAGAGAAATACAGG + Intergenic
919495963 1:198268351-198268373 CCAGAGTGCACGAGATAAACTGG - Intronic
921618201 1:217296906-217296928 CTGGAGTTCATTAGAAAAGCTGG - Intergenic
922935132 1:229416799-229416821 CTGATGTGAAGGAGAAAAACTGG - Intergenic
923213875 1:231831488-231831510 CTGATGTGAAGGAGAAAAACTGG + Intronic
924895872 1:248337519-248337541 CTGATGTGAAGGAGAAAAACTGG + Intergenic
1062943625 10:1443834-1443856 CTGGAGAGTATTAGAAAAAAAGG + Intronic
1063072753 10:2682688-2682710 CTGGAATGGATGAGAAAAGTTGG - Intergenic
1064175151 10:13068112-13068134 CGGGGTTCCATGAGAAAAACAGG - Intronic
1065869222 10:29941755-29941777 CTGGAGGGCTGGAAAAAAACAGG - Intergenic
1066624147 10:37389431-37389453 CTGGAGAGTTGGAGAAAAACTGG + Intergenic
1068966043 10:62912846-62912868 TTGGAGTGCATAAGTAAGACAGG - Intronic
1072272506 10:93790481-93790503 CTGGACCTCATGAGAAAAAAGGG - Intronic
1072561031 10:96574431-96574453 CTGGAGAGGATGGGAGAAACAGG + Intronic
1074057624 10:109937004-109937026 ATGAAGTACATGAGAAAGACTGG + Intergenic
1074057686 10:109937561-109937583 ATGAAGTACATGAGAAAGACTGG + Intergenic
1074584652 10:114755381-114755403 CTAGAAGGCAGGAGAAAAACAGG + Intergenic
1077859047 11:6158816-6158838 CTGGACTACTTGGGAAAAACAGG - Intergenic
1077967887 11:7155406-7155428 CTGGAGCTCAGGAGAAAATCTGG - Intergenic
1079648325 11:22894909-22894931 CTGCAGTGGATTAGAAACACCGG + Intergenic
1080587739 11:33696837-33696859 CTGGAGTTCAGGAGAAAGCCTGG - Intergenic
1080720971 11:34848314-34848336 CTGGAGTCAATGAGAATAATTGG + Intergenic
1081815849 11:45940810-45940832 ATGGAGTGAATGAGACAAACTGG + Intronic
1084354561 11:68629006-68629028 CTGATGTGAAGGAGAAAAACTGG - Intergenic
1085818211 11:79763943-79763965 CTGGATTGCAAGGGAAAAAATGG + Intergenic
1085988348 11:81810843-81810865 CTGATGTGAAGGAGAAAAACTGG - Intergenic
1086060889 11:82698826-82698848 CTGTAGTGAATGAGAAGCACTGG - Intergenic
1086958782 11:92961121-92961143 CTGGAGAGGAAGAGAAAGACTGG + Intergenic
1087524841 11:99296696-99296718 CTGGACTCCCTGGGAAAAACAGG - Intronic
1087961127 11:104350551-104350573 TTTGAGTGTATGAGGAAAACTGG + Intergenic
1089866727 11:121639208-121639230 CTGACGTGAAGGAGAAAAACTGG + Intergenic
1089953688 11:122551755-122551777 CTGATGTGAAGGAGAAAAACTGG - Intergenic
1089974688 11:122722311-122722333 CTGGAGTGCAGGAGAGAACCAGG - Intronic
1090978517 11:131695969-131695991 CTGGAGTGCATGAGAAAAACTGG + Intronic
1091347169 11:134863317-134863339 CTGGAGTGGATGAGGAAGCCAGG - Intergenic
1093241829 12:16686279-16686301 CTGAAATGCATGAGAGAATCTGG + Intergenic
1093612916 12:21184009-21184031 ATGGAGTGGATTATAAAAACTGG - Intronic
1093684699 12:22042867-22042889 GTGAAATGCATGAGAGAAACAGG - Intergenic
1094396485 12:30012144-30012166 CTGGAATGAAAGAGAAAATCAGG + Intergenic
1094681436 12:32670740-32670762 TTAGAGTGCCTGGGAAAAACAGG + Intergenic
1095877689 12:47099683-47099705 CTGAAGAGCATGAGGAAAACAGG + Intronic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1097541849 12:60953056-60953078 CTGATGTGAAGGAGAAAAACTGG + Intergenic
1098610434 12:72450780-72450802 CTGGAGAGGATGAGAAGAAAAGG - Intronic
1098979761 12:76943756-76943778 CTTGCCTGCATGAGAAAAATTGG - Intergenic
1099800071 12:87445517-87445539 CTGCAAGGCATGATAAAAACAGG + Intergenic
1100899265 12:99219843-99219865 CTAGAGGGCATGAGAATGACTGG - Intronic
1101188549 12:102307063-102307085 CTGGATTCCTTGGGAAAAACAGG + Intergenic
1102792223 12:115657218-115657240 CTGGAGTGAATGAGCAAGACAGG + Intergenic
1104522360 12:129487423-129487445 CAGGAGTGGATGAGGAAGACTGG + Intronic
1105734322 13:23252257-23252279 TTGGAATGAATGAGAAAAAATGG - Intronic
1105778998 13:23690160-23690182 CTGGAGAGCAGGAGGAAAGCTGG + Intergenic
1106690959 13:32115820-32115842 ATAGAGTGCATGTGAAAACCAGG - Intronic
1107922559 13:45224943-45224965 CTGCAGTGAATAAGAAAGACAGG + Intronic
1109624083 13:64952022-64952044 CAGGGGTGCAGGTGAAAAACTGG - Intergenic
1112468222 13:99663797-99663819 CAGGAGAGCAGGAGTAAAACGGG - Intronic
1112629768 13:101147908-101147930 ATGGAGTTCAAGAGAAAAAGAGG - Intronic
1113052372 13:106228415-106228437 CTGGAGTGATATAGAAAAACAGG + Intergenic
1114069214 14:19094809-19094831 CTGGAGTGGAGGAAAAAACCAGG - Intergenic
1114093046 14:19305194-19305216 CTGGAGTGGAGGAAAAAACCAGG + Intergenic
1114569691 14:23657942-23657964 CTGGAGTGCATGAGGCAGAGAGG - Intergenic
1115138577 14:30141540-30141562 TTGGAGTGCATGGGAACAATTGG - Intronic
1116678831 14:47939967-47939989 CTGGACTCCATGGGAAAAACAGG + Intergenic
1116681235 14:47972824-47972846 CTGGAGTACCTGAAAAAGACAGG - Intergenic
1116793680 14:49366558-49366580 CTCAAGTCCTTGAGAAAAACAGG - Intergenic
1120375830 14:83706066-83706088 CTGGAGTGACTTAGAACAACAGG + Intergenic
1120539255 14:85734255-85734277 CTGATGTGAAGGAGAAAAACTGG + Intergenic
1120621187 14:86766707-86766729 CAGGAGTACAAGAGAAAAATTGG + Intergenic
1121453584 14:94024773-94024795 CTGGAGTCCATGAGGAATTCTGG - Intergenic
1121482348 14:94288950-94288972 CTGGTGTGAATGAGACAAAGTGG - Intronic
1121581293 14:95034046-95034068 CTGGAGGGGATGAGAAACGCTGG + Intergenic
1121820570 14:96962495-96962517 CTGGAGTGAAGAAGCAAAACAGG + Intergenic
1122031718 14:98917101-98917123 CTGGAGGGCAAGAGAACAAAGGG + Intergenic
1123499963 15:20871959-20871981 CTGGTGAGGATGAGAAAACCTGG - Intergenic
1123557212 15:21445656-21445678 CTGGTGAGGATGAGAAAACCTGG - Intergenic
1123593436 15:21882924-21882946 CTGGTGAGGATGAGAAAACCTGG - Intergenic
1124132018 15:26998651-26998673 CTGGAGAGAGTGAGAAACACTGG + Intronic
1124515482 15:30363897-30363919 CTAGAGTGCATGAAAGAAGCTGG + Intronic
1124695653 15:31862277-31862299 CTGCTGTGCATAAGAATAACAGG - Intronic
1124727439 15:32166832-32166854 CTAGAGTGCATGAAAGAAGCTGG - Intronic
1124900982 15:33822250-33822272 CCGGAGTGCCTGAGAAACACCGG - Intronic
1128576440 15:68778973-68778995 CTGAGGGGCAGGAGAAAAACTGG + Exonic
1129267156 15:74399906-74399928 CTGGAATGCATGCCAAAAAGGGG - Intergenic
1129334022 15:74841922-74841944 GTTGAGTGTATGAGATAAACAGG + Intronic
1130905426 15:88237109-88237131 CTGAAATGCATCAGAAAAATAGG + Intronic
1131018728 15:89079901-89079923 CTGGAGGGTATGAGAAATGCTGG - Intergenic
1202965557 15_KI270727v1_random:172844-172866 CTGGTGAGGATGAGAAAACCTGG - Intergenic
1132902679 16:2267070-2267092 TTGGAGTGCTTAAGAATAACTGG - Intronic
1134057245 16:11178312-11178334 CTGGATTGGGGGAGAAAAACCGG - Intronic
1139006987 16:62584788-62584810 CTGCAGTGCAGTAGAAATACAGG + Intergenic
1143314601 17:6022759-6022781 CTGTGGTTCATGAGAAAAGCTGG + Intronic
1143721020 17:8809726-8809748 GTGGAATGGATAAGAAAAACAGG + Intronic
1144342332 17:14320143-14320165 CTGTAGAGCATGAGAATAAAGGG + Intronic
1145060994 17:19733587-19733609 CTGGGATGCATGAGGACAACAGG + Intergenic
1145415100 17:22708316-22708338 CTGGAGTGCATGTGTGAATCTGG - Intergenic
1145776011 17:27529486-27529508 CTGGAGGGCAGCAGAGAAACAGG - Intronic
1146320144 17:31840560-31840582 GAGGAGAGCATGGGAAAAACAGG + Intergenic
1146529404 17:33595413-33595435 CTGTAGTGCCTTAGAACAACCGG - Intronic
1146768645 17:35547783-35547805 CTGGGGTGCATGAGAAACATGGG + Intergenic
1148263041 17:46200959-46200981 CTGGAGTGCATGGCAAAATCTGG + Intronic
1149633708 17:58148908-58148930 CTGGAGTGAGTGAGAGAAGCAGG - Intergenic
1153925012 18:9827932-9827954 CTGGACTGCATCAGACCAACTGG - Intronic
1153971990 18:10235468-10235490 AAGGAGTTAATGAGAAAAACAGG + Intergenic
1155017654 18:21861126-21861148 CTGGATTTCAAAAGAAAAACTGG - Intronic
1155637216 18:27970179-27970201 CTGGATTGCATCAAAACAACGGG - Intronic
1159782060 18:72671486-72671508 GTGGAATGGATGTGAAAAACTGG - Intergenic
1160041005 18:75345408-75345430 CTGTCGTGCATGAGCAAAAATGG - Intergenic
1163899842 19:20091527-20091549 CTGAAGCGAAGGAGAAAAACTGG + Intronic
1164153289 19:22572667-22572689 CTGAAGTGAAGGAGAAAAACTGG - Intergenic
927171618 2:20375203-20375225 CTGGAGTGCAAGCCACAAACAGG + Intergenic
927522739 2:23709998-23710020 CAGGAGTCCATGAGACAAAGGGG + Intergenic
931061264 2:58532252-58532274 CCAGAATGCATGAAAAAAACTGG - Intergenic
931685872 2:64792470-64792492 CTGGACTGCATGATCAAAACAGG + Intergenic
931837643 2:66115940-66115962 CTGAAGTAAATGGGAAAAACTGG - Intergenic
932077873 2:68681990-68682012 CTGGAAATCTTGAGAAAAACGGG + Intronic
932695922 2:73956488-73956510 GTGGAGTGAAGGGGAAAAACTGG + Intronic
933125058 2:78594019-78594041 ATTGATTGCCTGAGAAAAACAGG - Intergenic
934092931 2:88569883-88569905 CTGAAGTACATGAGGAAATCTGG - Intronic
938991196 2:136631670-136631692 CTGGTTGGCATGATAAAAACTGG - Intergenic
939722207 2:145667878-145667900 CTGGAGGACCTGGGAAAAACGGG - Intergenic
940443270 2:153745075-153745097 CTGAGGTCCATTAGAAAAACAGG + Intergenic
941455823 2:165711405-165711427 CTGAAGTGAAGGAGAAAAACTGG + Intergenic
941865828 2:170333346-170333368 ATGGAGTGAATGAGATAAAGAGG + Intronic
943412617 2:187561768-187561790 CTGAAGTGAAGGAGAAAAACTGG + Intronic
943420413 2:187661757-187661779 TTGGAGTGTATGAGACAATCAGG - Intergenic
943538518 2:189182604-189182626 CTGGAATATATGAGAAAATCAGG + Intergenic
943991235 2:194695432-194695454 CTGGAATGCATGAAGACAACAGG + Intergenic
944727030 2:202481988-202482010 CTGGAGGGCCTGAGAAGAAGGGG - Intronic
945806129 2:214491887-214491909 CTGGAGTACAAGAGAAAAAGGGG - Intronic
945925284 2:215797009-215797031 TTGGAGAGGATGAGAAACACTGG - Intergenic
946199401 2:218063002-218063024 ATGGACTGAATGAGAAGAACAGG - Intronic
946456053 2:219826949-219826971 CTGCAGGGCCTGAGAAAAAGGGG + Intergenic
947857605 2:233334680-233334702 ATGGAGTTAATGAGACAAACTGG - Intronic
1170304932 20:14928045-14928067 CTGGCGTGCAAAAGAAAAACTGG + Intronic
1171400815 20:24872125-24872147 CTGGAATCAATGAGATAAACGGG + Intergenic
1171518403 20:25757668-25757690 CTGGAGTGCATGTGTGAATCTGG - Intergenic
1171558452 20:26098538-26098560 CTGGAGTGCATGTGTGAATCTGG + Intergenic
1172795571 20:37534897-37534919 CTGGAGAGCAAGAGAAGAAGTGG - Intergenic
1175438033 20:58968329-58968351 CTGAAGTGAAAGAGAAAAAAGGG + Intergenic
1175519400 20:59590354-59590376 CTGGAGTAGATGACAAGAACTGG + Intronic
1175737898 20:61399895-61399917 CAGGAGTGCGTGAGAACCACTGG - Intronic
1176249821 20:64115258-64115280 CTGAAGGGCATGTGACAAACAGG - Intergenic
1177119891 21:17125920-17125942 CTGATGTGAAGGAGAAAAACTGG - Intergenic
1177811311 21:25927496-25927518 CTGGAGGTCAAGATAAAAACTGG - Intronic
1179537270 21:42060650-42060672 CTGGAGTGCATGACAGGATCTGG - Intergenic
1180487687 22:15817372-15817394 CTGGAGTGGAGGAAAAAACCAGG - Intergenic
1183079100 22:35444929-35444951 CTGGGCTGCATGAGCATAACTGG - Intergenic
1184059303 22:42072511-42072533 CTGCCTTGCAGGAGAAAAACAGG + Intergenic
1184147673 22:42620774-42620796 ATGGAGTCCATGAGATAAAGAGG - Intronic
1184824087 22:46935326-46935348 CTGGAGTACATGAGAAAAAATGG + Intronic
1184885864 22:47344107-47344129 CTGGAGGGCATGGGGAAAGCAGG + Intergenic
1185107175 22:48880037-48880059 CTGGAGTTCAAGGGCAAAACTGG - Intergenic
949220156 3:1623188-1623210 CTGGACTGCTTTAGGAAAACAGG + Intergenic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
953524395 3:43676407-43676429 CTGGAGTGCAGGTGCAAACCTGG - Intronic
955856340 3:63277843-63277865 CTGGGGTACATCAAAAAAACAGG - Intronic
956310250 3:67870848-67870870 CTGGAGTGACTGTGAAAAATAGG + Intergenic
956969840 3:74509658-74509680 CTGGAGAGGATGAGTTAAACCGG + Intronic
957172264 3:76752691-76752713 CTGAAGTGTTTGAGGAAAACTGG + Intronic
958106822 3:89085041-89085063 ACGGAGTGCATGTGAATAACTGG - Intergenic
958676483 3:97274263-97274285 CTGACGTGAAGGAGAAAAACTGG + Intronic
960121749 3:113954166-113954188 CTGGAGTGCCTGAGCAGAAAAGG + Exonic
962583886 3:136821870-136821892 CTGGAGGGCAGGGGAAAATCAGG - Intronic
963108659 3:141666757-141666779 CTGGAGTGTAAGAAAAAAACAGG - Intergenic
964125145 3:153227964-153227986 CTGATGTGAAGGAGAAAAACTGG + Intergenic
964299913 3:155276252-155276274 CTGATGTGAAGGAGAAAAACTGG + Intergenic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
965646489 3:170887465-170887487 GTGGAGTGCATAAGTTAAACAGG + Intergenic
967250588 3:187533994-187534016 GTGGAGGGCATGAGAAAATAAGG + Intergenic
969253582 4:5987909-5987931 CTGTAGAGCATGATAAAACCAGG - Intronic
969420078 4:7088923-7088945 CTGGACTCCTTGAGAAAAACAGG - Intergenic
970001497 4:11369615-11369637 TTGGAGTGCTTAAGAATAACTGG + Intergenic
970748279 4:19326871-19326893 CTGCAGTGTATACGAAAAACTGG + Intergenic
970853749 4:20631580-20631602 CTGATGTGAAGGAGAAAAACTGG + Intergenic
970903531 4:21188247-21188269 CTGGAGTGAAGGATAAACACAGG + Intronic
971061142 4:22971335-22971357 AAACAGTGCATGAGAAAAACTGG + Intergenic
971428169 4:26536305-26536327 GTGGAGTGCAGGAGAAAAGTTGG - Intergenic
974861071 4:67522513-67522535 CTGGAGAGAATAAGAAAGACAGG + Intronic
977225032 4:94384753-94384775 CTCGTGTGAAGGAGAAAAACTGG + Intergenic
977894092 4:102344907-102344929 CTGGAGAGCCTGAGATAAAGAGG + Exonic
978426279 4:108586095-108586117 CTGGACTGCAAGAGAATAATTGG + Intergenic
979618205 4:122768512-122768534 CTTCAGTGCATGAAAAAAAATGG + Intergenic
981874277 4:149521854-149521876 CTGGAGAGCATGAGTAAATCCGG + Intergenic
982396418 4:154920137-154920159 CTGATGTGAAGGAGAAAAACTGG + Intergenic
983712374 4:170734786-170734808 CTGGAGTGAATGAAAAGGACTGG + Intergenic
983748158 4:171227977-171227999 CTGGAGTTCTTGAAAAAATCAGG - Intergenic
983881369 4:172936973-172936995 CTAGAGTGCTTGAGATAAACTGG + Intronic
983952942 4:173663202-173663224 CTGGTGTGAATGAGTAAAATGGG + Intergenic
983986879 4:174070185-174070207 GTGGAGTGCAGCAGGAAAACAGG - Intergenic
984322499 4:178211512-178211534 CTGATGTGAAGGAGAAAAACTGG - Intergenic
985015248 4:185627065-185627087 CGGGTGTGCACCAGAAAAACCGG + Intronic
986084598 5:4431670-4431692 CTGGAGAGGATGAGGAGAACAGG - Intergenic
986201247 5:5580778-5580800 CTGGAGTTGAGGAGAAAGACTGG - Intergenic
986889569 5:12285023-12285045 CTGAAGTGAATGAGATAAGCAGG + Intergenic
987687519 5:21224700-21224722 CTGGAGGGCATCAGAAAAAAAGG + Intergenic
987825858 5:23029546-23029568 AGGGAGTAAATGAGAAAAACAGG - Intergenic
988482682 5:31642784-31642806 CTGGAGAGAATGAGGAAAACAGG + Intronic
990290593 5:54346761-54346783 CTGGACTTCTTGGGAAAAACAGG + Intergenic
991066778 5:62432379-62432401 CTGGGGTGTATGAGAAATACTGG + Intronic
993341054 5:86725539-86725561 CTGGTGAGGATGAGAGAAACAGG - Intergenic
993554161 5:89314945-89314967 TTGTTGTGCATGAGAAAATCTGG + Intergenic
995417358 5:111925758-111925780 CTGGAGGGCCTATGAAAAACTGG - Intronic
996137638 5:119864568-119864590 CTGAAATGCAAGAGAAAAAAAGG - Intergenic
996336741 5:122391908-122391930 CTGGAGTGCCCCAGCAAAACTGG + Intronic
996576215 5:124978871-124978893 CTGGAGTGCATGTGGCAAAATGG - Intergenic
998732557 5:145097013-145097035 CTGGAGAGCATGTGAGAAAGAGG - Intergenic
999544346 5:152610393-152610415 CAGGTGTGCATTAGAAAGACAGG - Intergenic
1000681016 5:164184750-164184772 CTGGAGTGCATGACACAATCTGG + Intergenic
1003564207 6:7208696-7208718 CTGCAGTCCTTGAGCAAAACTGG + Intronic
1004292210 6:14377929-14377951 CTGGAGTTCATGAGAGACAGCGG - Intergenic
1004589665 6:17037055-17037077 ATGGAGTGGATGAAAAAAAAAGG + Intergenic
1005809785 6:29506763-29506785 GTGGAGTGGATGAAAAGAACAGG + Intergenic
1006819465 6:36880266-36880288 CTGGAATCCATGGGAAAAACAGG + Intronic
1007821539 6:44563969-44563991 CTGGAGAGCCTGATAAACACAGG + Intergenic
1008217376 6:48810055-48810077 CAGGAGAGCATCAGAGAAACTGG - Intergenic
1010346895 6:74821713-74821735 CTGGAGAGGATGAGGAAAAAGGG + Intergenic
1011263411 6:85491184-85491206 CTGCAGTCCATGAGATAAACAGG - Intronic
1011695280 6:89906973-89906995 AAGGTGTGCATGACAAAAACAGG - Intergenic
1013906633 6:115227569-115227591 CTGGAGAGGATGTGAAAAATTGG + Intergenic
1014142111 6:117955751-117955773 CAGGCATGCATGAGAAAAAGTGG - Intronic
1014169435 6:118262386-118262408 CTGGAGTGGAAAAGAAAAAGAGG + Intronic
1014855712 6:126398057-126398079 CAGGACTGTCTGAGAAAAACTGG - Intergenic
1015757217 6:136619851-136619873 GTGGAGTGCAAGAGAAAGAGAGG + Intronic
1016685859 6:146881380-146881402 CTGGAAAGAAGGAGAAAAACTGG + Intergenic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1020330831 7:7015382-7015404 CTGGAGTTCATTTTAAAAACAGG + Intergenic
1020540783 7:9459558-9459580 CTGATGTGAAGGAGAAAAACTGG + Intergenic
1022210125 7:28200555-28200577 CTAGAGTTCTTCAGAAAAACAGG + Intergenic
1023030851 7:36089436-36089458 TGGGAGTGTATGAGAAAATCTGG + Intergenic
1024811928 7:53222155-53222177 ATGAAGAGCATGAGAAAAATGGG + Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1026896493 7:74012888-74012910 CTGGAGTGCAGGAGGGAAGCTGG + Intergenic
1028470468 7:91200932-91200954 CTAGAATGAAAGAGAAAAACAGG - Intronic
1030259990 7:107553437-107553459 TTTGAGTACATGAGAAATACTGG + Intronic
1031305068 7:120115718-120115740 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1031354891 7:120778423-120778445 CTGATGTGAAGGAGAAAAACTGG + Intergenic
1032071302 7:128809060-128809082 CTGGGGTTAATGAGAATAACAGG + Intronic
1032554717 7:132819908-132819930 CTGAAGTGCATGAGAAAAGATGG + Intronic
1032971629 7:137170935-137170957 CTGGAATTCATTAGAAAAAACGG + Intergenic
1033435246 7:141327948-141327970 CTGGAATGCATGAGGAAGCCAGG - Intronic
1036468951 8:9032733-9032755 TTGGAGACCAGGAGAAAAACTGG + Exonic
1036959176 8:13225362-13225384 CAGGAGTGGATGTGAACAACCGG + Intronic
1038024725 8:23578183-23578205 CTGGAGTTCAGGAGAAGAATCGG - Intergenic
1038485338 8:27931189-27931211 CTGGGATGCAGGAGAAAACCAGG + Intronic
1038898246 8:31812188-31812210 CTGGAATTTATTAGAAAAACAGG + Intronic
1038924316 8:32121303-32121325 TTTGAGTGCATGAAAAACACTGG + Intronic
1040400774 8:47047171-47047193 CTGGAGTACATGAAACAGACAGG + Intergenic
1040999029 8:53431465-53431487 CTGGAGTGCTTGGGAAAATGTGG - Intergenic
1041960096 8:63604882-63604904 CTGGAGCCCATGACAAAAAAAGG - Intergenic
1042165256 8:65938946-65938968 CTGAAGTGCATGGGAAACCCAGG - Intergenic
1042671792 8:71272204-71272226 CTGGAATGAATGAGAGAAGCGGG - Intronic
1043833966 8:85024455-85024477 ATGGAGTACTTGAGAAAAATAGG + Intergenic
1044484167 8:92730651-92730673 CTGTTGTTCATGAGACAAACAGG + Intergenic
1045333001 8:101172661-101172683 GAGGAGTGCATGTGGAAAACAGG + Intergenic
1045517334 8:102871620-102871642 ATGGTGTGCATGACAAAAAAAGG + Intronic
1046655168 8:116885955-116885977 TTGGTGAGCATGTGAAAAACTGG - Intergenic
1046971728 8:120230545-120230567 CGGGATTGCAAGAGAAAAACGGG - Intronic
1048966917 8:139621839-139621861 CTGGAATGCTGGAGAATAACAGG + Intronic
1049500526 8:142960955-142960977 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1050401593 9:5261953-5261975 CTGGGGTTCGTGAGGAAAACAGG + Intergenic
1050448139 9:5749295-5749317 CTGGAGTGCCAGCGAAATACAGG - Intronic
1050782532 9:9355651-9355673 CTGGATTTCATGAGAAAGACAGG + Intronic
1051459956 9:17300786-17300808 CTGGAGTGAATAAGAAAAGAAGG - Intronic
1051670643 9:19506341-19506363 TTGGAGTGCTTGAGAAAATCAGG + Intergenic
1051824356 9:21202386-21202408 TTTGAGTGCAGGGGAAAAACAGG - Intergenic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1052783636 9:32807457-32807479 TTGAACTGCATGATAAAAACAGG - Intergenic
1053512356 9:38699278-38699300 CTGGAGTGGGTGAGGACAACTGG + Intergenic
1053604599 9:39644669-39644691 ATGGAGTGGTGGAGAAAAACTGG - Intergenic
1053862414 9:42400688-42400710 ATGGAGTGGTGGAGAAAAACTGG - Intergenic
1054248943 9:62697745-62697767 ATGGAGTGGTGGAGAAAAACTGG + Intergenic
1054563053 9:66732278-66732300 ATGGAGTGGTGGAGAAAAACTGG + Intergenic
1055882035 9:81013446-81013468 CTGATGTGAAGGAGAAAAACTGG - Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1056324202 9:85463074-85463096 CCGAAGTGAAGGAGAAAAACTGG - Intergenic
1058025888 9:100141990-100142012 CTGACGTGAAGGAGAAAAACTGG + Intronic
1058453646 9:105119473-105119495 CTGGAGAGCCTGAGAACCACAGG - Intergenic
1058657555 9:107237400-107237422 CTGGAGTTCAGAAGAAACACAGG + Intergenic
1060241554 9:121908115-121908137 GTGGAATGCATAAGAAAAAGGGG + Intronic
1061461420 9:130742407-130742429 CTGAAGTGCATTGGGAAAACTGG + Intronic
1185518526 X:719002-719024 CTGGAGTACATGTGCAGAACGGG + Intergenic
1189172713 X:38925098-38925120 CAGGAGTGGATGAGAAAACCTGG - Intergenic
1189480671 X:41390060-41390082 CTGAAGTGCAGCAGGAAAACTGG + Intergenic
1190849973 X:54230524-54230546 CTGAAGAGCATCAGAAAAACTGG + Intronic
1192005879 X:67211846-67211868 CTGGATTTCCTGAGAAAAATCGG + Intergenic
1194227453 X:91279020-91279042 TTGGGTTCCATGAGAAAAACAGG + Intergenic
1194661028 X:96628667-96628689 CTGATGTGAAGGAGAAAAACTGG - Intergenic
1194768918 X:97876789-97876811 TTGAAGTGCCTGAGAAAAATTGG + Intergenic
1194873456 X:99160528-99160550 CTGATGTGAAGGAGAAAAACTGG + Intergenic
1194996102 X:100593111-100593133 TTAGAGTGCAGGAGAAAATCTGG + Intronic
1195407084 X:104526796-104526818 CTGGAGTGACTGAGAAAATATGG + Intergenic
1196677574 X:118436995-118437017 CTGATCTGCATTAGAAAAACTGG + Intronic
1197960825 X:132004498-132004520 CTAAAGTACATGAGAAAAAAAGG - Intergenic
1198814870 X:140579048-140579070 CTGGCTTACAGGAGAAAAACTGG - Intergenic
1199177724 X:144811248-144811270 CTGTAGTACATTAGAACAACAGG + Intergenic
1199234650 X:145477060-145477082 TTGGAATTCATGACAAAAACTGG - Intergenic
1199390589 X:147273303-147273325 GTGGAGTGGATGAGAAATTCTGG - Intergenic
1199976159 X:152896053-152896075 CTGGAGAGCATGAGCAAATGTGG - Intergenic
1200166048 X:154036139-154036161 GGGGAGTGCAAGAGAAAAACAGG + Intronic
1202088077 Y:21160141-21160163 CTGGACTGTATGAGAAAAGCAGG + Intergenic