ID: 1090979209

View in Genome Browser
Species Human (GRCh38)
Location 11:131702186-131702208
Sequence ACCAGGGATCGGCCCACACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 113}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090979204_1090979209 -1 Left 1090979204 11:131702164-131702186 CCACATCTTCCATCTCACTTTCA 0: 1
1: 1
2: 6
3: 62
4: 586
Right 1090979209 11:131702186-131702208 ACCAGGGATCGGCCCACACTTGG 0: 1
1: 0
2: 0
3: 1
4: 113
1090979201_1090979209 22 Left 1090979201 11:131702141-131702163 CCTTACAAAGCAGAGTTCCTGAC 0: 1
1: 0
2: 1
3: 10
4: 151
Right 1090979209 11:131702186-131702208 ACCAGGGATCGGCCCACACTTGG 0: 1
1: 0
2: 0
3: 1
4: 113
1090979203_1090979209 0 Left 1090979203 11:131702163-131702185 CCCACATCTTCCATCTCACTTTC 0: 1
1: 1
2: 6
3: 48
4: 516
Right 1090979209 11:131702186-131702208 ACCAGGGATCGGCCCACACTTGG 0: 1
1: 0
2: 0
3: 1
4: 113
1090979202_1090979209 5 Left 1090979202 11:131702158-131702180 CCTGACCCACATCTTCCATCTCA 0: 1
1: 1
2: 1
3: 30
4: 318
Right 1090979209 11:131702186-131702208 ACCAGGGATCGGCCCACACTTGG 0: 1
1: 0
2: 0
3: 1
4: 113
1090979207_1090979209 -10 Left 1090979207 11:131702173-131702195 CCATCTCACTTTCACCAGGGATC 0: 1
1: 0
2: 1
3: 18
4: 178
Right 1090979209 11:131702186-131702208 ACCAGGGATCGGCCCACACTTGG 0: 1
1: 0
2: 0
3: 1
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090979209 Original CRISPR ACCAGGGATCGGCCCACACT TGG Intronic
900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG + Intronic
901227603 1:7623216-7623238 ACCAGGGACTGGCCTACATTTGG - Intronic
906187750 1:43873943-43873965 CCCAGAGAATGGCCCACACTTGG + Intronic
907865686 1:58397225-58397247 ACCTGTGATCAGCCCATACTCGG + Intronic
913350638 1:117854924-117854946 AACAGTGCTTGGCCCACACTAGG - Intergenic
915565263 1:156709394-156709416 ACCAAGGATCAGGCCAGACTGGG - Intergenic
916718219 1:167462608-167462630 AGCAGGGATCGGCCCCCAAAAGG - Intronic
917967266 1:180186605-180186627 GCCAGGGATCGGGTCAGACTGGG - Intronic
923541149 1:234889055-234889077 ACCAGGGGCTGGCCCACAGTTGG + Intergenic
1069901819 10:71710821-71710843 CCCATGGAGTGGCCCACACTGGG + Intronic
1071839110 10:89450576-89450598 GGCAGGGAACGGCACACACTGGG + Intronic
1076454604 10:130581208-130581230 TACAGGGATCGGCCCACAGGTGG - Intergenic
1077265704 11:1648485-1648507 GCCAGGGCTCGGCCCGCAGTGGG - Intergenic
1078578304 11:12519344-12519366 ACCAGGGCATGGCCCCCACTAGG - Intronic
1078633928 11:13031189-13031211 ACCAGGGAAGCTCCCACACTAGG - Intergenic
1084839541 11:71833835-71833857 ACCAGGGATGACCCCACACCAGG + Intronic
1084954581 11:72684577-72684599 ACCAGGGGGCTGCCCTCACTGGG - Intergenic
1085520712 11:77137597-77137619 ACCAGGCGTCGGTCCACGCTGGG - Intronic
1090979209 11:131702186-131702208 ACCAGGGATCGGCCCACACTTGG + Intronic
1093098633 12:15000766-15000788 ACCAGAGATTGTGCCACACTTGG + Intergenic
1093489425 12:19688072-19688094 TCCAGTGATCGGCCCACCCCAGG - Intronic
1093870396 12:24284299-24284321 TCCAGGGATCAGCCTACACCAGG - Intergenic
1096469347 12:51866261-51866283 TTCAGGGATTGGCCCACCCTGGG - Intergenic
1099630943 12:85144682-85144704 GCCAGGGATCAGTCCACATTAGG + Intronic
1103919680 12:124392953-124392975 TCCAGGGAGCGGCCAACAGTGGG - Intronic
1106103997 13:26718146-26718168 CACAGGGACTGGCCCACACTGGG - Intergenic
1109200139 13:59421177-59421199 ACCAGGGAATGGCCCTCATTAGG - Intergenic
1119423525 14:74522102-74522124 ACCAGCAACCTGCCCACACTAGG + Intronic
1121856091 14:97271443-97271465 ACCACGGATGGCCTCACACTTGG - Intergenic
1122975528 14:105169188-105169210 ATCAGGGCTCGGCCCCCACGCGG + Intergenic
1128468964 15:67936022-67936044 ATCAGGGATAGGACCACAGTGGG - Intergenic
1129412348 15:75356884-75356906 TCCAGCGATGGGCCCACACCTGG + Exonic
1129658773 15:77541709-77541731 ACCAGGGCTCCACACACACTTGG + Intergenic
1129718603 15:77865761-77865783 ACCAGGGCTGGGCACACACCAGG + Intergenic
1130108506 15:80946626-80946648 GCCAGGGCTCGGCACACAGTAGG - Intronic
1132899138 16:2243967-2243989 ACCAGGCTCCGGCCCACACCCGG + Intronic
1133232967 16:4374965-4374987 ACCAGGGCTGGGCCCTCACACGG - Intronic
1134000470 16:10778999-10779021 ACCATGGGTCAGCGCACACTTGG - Intronic
1136076564 16:27821227-27821249 AGCAGAGATCTGGCCACACTGGG - Intronic
1141720188 16:85751416-85751438 ACCAGGGTTCCTCCCATACTGGG + Intergenic
1144575911 17:16429347-16429369 AACAGGGCCCGGCCCACAGTAGG - Intronic
1144890268 17:18490361-18490383 CCCAGGACTCGGCCCACAATAGG + Intronic
1145141948 17:20453957-20453979 CCCAGGACTCGGCCCACAATAGG - Intronic
1145793952 17:27644942-27644964 CCCAGGAATCGACCCACAATAGG + Intronic
1145808753 17:27752477-27752499 CCCAGGAATCAGCCCACAGTAGG + Intergenic
1147367816 17:39970851-39970873 CGCAGGGATCTGCCCTCACTGGG - Intronic
1147864879 17:43545651-43545673 ACCAGGTCTCGGCCCCCGCTTGG - Exonic
1148333685 17:46827264-46827286 GCCAGGGATTGGCCTAAACTGGG + Intronic
1148736461 17:49867943-49867965 ACCAGAGATGGGCCCACATGGGG + Intergenic
1152377139 17:79924724-79924746 GCCAGGGAGGGGCCCACATTGGG - Intergenic
1154311829 18:13272847-13272869 ACCAGGAATCTGCACTCACTGGG - Intronic
1160605139 18:80044570-80044592 ACCAGGGCTTGGCACACAGTGGG - Intronic
1161267967 19:3373766-3373788 ACCTGGGCTCGGCCCTCACCTGG - Intronic
1162868416 19:13566774-13566796 ACCATGGATCTCCACACACTGGG + Intronic
1163288925 19:16365859-16365881 CCCAGGGCTCGGCACACAGTGGG + Intronic
1163535088 19:17872335-17872357 ACCGGGGAACGGCCCACCTTCGG + Exonic
1163987956 19:20970719-20970741 GCCAGGGCTCTGCCCACAGTAGG + Intergenic
1164789178 19:30961522-30961544 CCCAGGGCTCTACCCACACTGGG - Intergenic
1166290623 19:41860909-41860931 GCCAGGGACCGGCAAACACTGGG - Intronic
1168648542 19:58077548-58077570 TCCTGGGATGGGGCCACACTTGG - Intronic
925179235 2:1806221-1806243 CCCAGGCATCAGCACACACTTGG + Intronic
926767199 2:16331920-16331942 GCCAGGGAGCAGCCCACCCTGGG - Intergenic
931214506 2:60228530-60228552 AGCAGGGTCAGGCCCACACTAGG - Intergenic
931706660 2:64951850-64951872 TCCAGGGATGGGGCTACACTAGG + Intergenic
934726043 2:96619642-96619664 ACCAGCAATCCGCCCACAGTGGG - Intronic
935746374 2:106193620-106193642 GCCGGGGAGCCGCCCACACTTGG + Intronic
940523528 2:154782367-154782389 AACAGTGATCGGCCCATAGTAGG + Intronic
943425803 2:187732148-187732170 AGCAGGGACCTGCCCACACCTGG + Intergenic
944025553 2:195162219-195162241 TGCAGGGATCAGCCCCCACTAGG - Intergenic
1169662968 20:8000629-8000651 ACCTGGGATTGGCCAACATTAGG - Intronic
1172414032 20:34749803-34749825 ACCAGGGCCCAGCCCACACATGG - Exonic
1175413307 20:58785477-58785499 TCCAGGGAAATGCCCACACTGGG - Intergenic
1177078560 21:16609569-16609591 ACCAGGGATGGGCCGACAGAAGG + Intergenic
1179162703 21:38911104-38911126 ACCTGGGATCAGCCTTCACTGGG - Intergenic
1182049890 22:27304624-27304646 ACCATGGTTCTGCCCACTCTGGG - Intergenic
950865182 3:16183071-16183093 ACCAGAGACAGGCACACACTGGG - Intronic
951962798 3:28348450-28348472 ACTAGGGAGCGGCCCACTCCTGG - Intronic
955596943 3:60601199-60601221 AGCAGGGTGCAGCCCACACTGGG - Intronic
961429475 3:126871214-126871236 AGAAGGGATAGGCCCATACTGGG - Intronic
966927964 3:184657902-184657924 AGCAGGGACCAACCCACACTTGG - Intronic
970439532 4:16068113-16068135 ACCAGGGACCAGCCCTCACCTGG - Intronic
971479574 4:27102271-27102293 ACCTGGGAGCTGCTCACACTTGG + Intergenic
976890462 4:90040042-90040064 ACCAGGGATCGGTGAATACTGGG - Intergenic
980079317 4:128327136-128327158 ATCAGTGATGGCCCCACACTGGG - Intergenic
983897576 4:173098489-173098511 ACACGGGATTGGCTCACACTTGG + Intergenic
984638880 4:182142786-182142808 ACCAGGGAGCCGCACTCACTCGG + Intergenic
998181786 5:139951132-139951154 TCCAGGGCTTGGCCCACATTAGG - Intronic
998641624 5:144018288-144018310 TCCAGGCATCTGCCCACTCTGGG + Intergenic
1003639651 6:7865855-7865877 ACCAGGGATCGTCCTACATCTGG + Intronic
1005159757 6:22845072-22845094 ACAAGAGATCTGCCTACACTGGG - Intergenic
1006345552 6:33478966-33478988 ACCAGTGATGTGCACACACTGGG - Intergenic
1006448642 6:34093269-34093291 CCCAGGGATAGGGACACACTAGG - Intronic
1007110043 6:39308222-39308244 ACCAGTGTCTGGCCCACACTAGG + Intronic
1019735855 7:2649451-2649473 ATCAGGGGTCAGCCCACACATGG - Intronic
1020258085 7:6513699-6513721 ACCAGGGCTAGGCCCACACGTGG - Intronic
1024326939 7:48116237-48116259 ACCAGTGACCAGCCCACACAGGG - Intergenic
1024326956 7:48116321-48116343 ACCAGTGACCAGCCCACACAGGG - Intergenic
1024326997 7:48116536-48116558 ACCAGTGACCAGCCCACACAGGG - Intergenic
1024327007 7:48116579-48116601 AACAGTGATCAGCCCACACACGG - Intergenic
1024327024 7:48116665-48116687 ACCAGTGACCAGCCCACACAGGG - Intergenic
1028387324 7:90271174-90271196 ACCAGGGATCAGCAAACTCTGGG + Intronic
1032833599 7:135653020-135653042 GGCAGGGAAAGGCCCACACTGGG - Intergenic
1033732756 7:144195417-144195439 CCCAGGGATCAGCCCCCGCTGGG - Intronic
1033743607 7:144293997-144294019 CCCAGGGATCAGCCCCCGCTGGG - Intergenic
1033750295 7:144355600-144355622 CCCAGGGATCAGCCCCCGCTGGG + Intronic
1034210744 7:149359874-149359896 GCCAGGCCTCGGACCACACTGGG - Intergenic
1034450016 7:151132248-151132270 ACAACCGCTCGGCCCACACTTGG - Intronic
1035020231 7:155796573-155796595 AGCAGGGAGCGGCACAGACTTGG - Intergenic
1041713188 8:60911277-60911299 CCCAGGGATCAGCCCAGATTGGG - Intergenic
1042591381 8:70402484-70402506 ACCAGGGACCGACCCACCCCCGG + Intronic
1052851597 9:33381578-33381600 ACCAGGGAAGGGCCCACAGCTGG - Intergenic
1061869988 9:133515399-133515421 ACCAGGGCTGTGCCCACGCTGGG - Intronic
1062633179 9:137476379-137476401 ACTAGTGATGGGACCACACTGGG + Intronic
1190277672 X:48909785-48909807 ACCAGGGATGGGGCTGCACTGGG - Intronic
1196691433 X:118562972-118562994 ACCAGGGTTCTGCACACAGTAGG + Intronic