ID: 1090981115

View in Genome Browser
Species Human (GRCh38)
Location 11:131723300-131723322
Sequence ACACTCTCCCATCCATCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 109}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090981115 Original CRISPR ACACTCTCCCATCCATCATC AGG (reversed) Intronic
902773270 1:18658502-18658524 TCACTTTCCCTTCCATCATGTGG - Intronic
905290847 1:36920799-36920821 TCACTCCCCCAACCATTATCAGG - Intronic
905639246 1:39577035-39577057 ACACCCTCCCACCCATCACCCGG + Intergenic
912777499 1:112514990-112515012 ACACTCTCGGATCCATTCTCGGG - Exonic
914585760 1:149060338-149060360 CCACTGACCCATCCCTCATCTGG + Intronic
915571041 1:156745146-156745168 ACAGTCTCCCATCTCTCACCAGG - Exonic
917164086 1:172091863-172091885 AGACACTGCCATCCCTCATCTGG - Intronic
919697367 1:200591628-200591650 ACACTCTCCCAGTCTTCCTCTGG + Intronic
920230497 1:204466803-204466825 AGACTCCCCCAGCCAGCATCGGG - Intronic
920527206 1:206675843-206675865 CCACTCTCCCTTCCACCATGAGG - Intronic
921386064 1:214571076-214571098 CCACTCTCCCTCCCATTATCTGG - Intergenic
923724502 1:236494720-236494742 ACCCCCTTCCATCCATCTTCTGG + Intergenic
923728051 1:236524173-236524195 ACACTGTCCCACCCATCAAATGG - Intronic
1065526276 10:26624428-26624450 ACACTCCCCCATCCCCCATTTGG - Intergenic
1067662088 10:48243759-48243781 ACCCTCTCCAATTCAACATCCGG - Intronic
1067957986 10:50814163-50814185 AGAGTCTCCCACCCATCTTCAGG - Intronic
1071124016 10:82313619-82313641 TCATTCCCACATCCATCATCAGG - Intronic
1071220726 10:83462090-83462112 TCTCTCTCCCATTCATCTTCAGG - Intergenic
1072617808 10:97060852-97060874 ACCCTATCCCATCCATCAGTCGG - Intronic
1074826776 10:117220418-117220440 AAAGTCTCCCATCCAACATGTGG - Intergenic
1076014251 10:127015131-127015153 AAACTCTCCCTCCCATGATCTGG + Intronic
1077412712 11:2410946-2410968 AGGCTGTCCCAGCCATCATCCGG - Intronic
1081722193 11:45298494-45298516 ACTCTCTCACATACATGATCAGG + Intergenic
1084934726 11:72580796-72580818 ACTCGCTCCCACCCATCTTCAGG + Intronic
1085837920 11:79976150-79976172 ACACTGTCATAGCCATCATCTGG - Intergenic
1088379155 11:109173916-109173938 ACACTATCCCAGCCAACACCAGG - Intergenic
1090556458 11:127881921-127881943 ACACTCTCCTCTCAATCATATGG + Intergenic
1090981115 11:131723300-131723322 ACACTCTCCCATCCATCATCAGG - Intronic
1092653977 12:10665507-10665529 ACACTTTCCCACCCTTCATAAGG + Intronic
1093376069 12:18429472-18429494 ACCCTCTCCCAGCCACCATCTGG + Intronic
1104590073 12:130077214-130077236 ACACTCCCCCGTCCACCATTGGG + Intergenic
1107817807 13:44259818-44259840 ACACTCACCCATTCATCCCCTGG - Intergenic
1116858834 14:49977701-49977723 CCAATCTCCCATCCAGCATCTGG - Intergenic
1117886275 14:60367350-60367372 ACACTGCCCCATCCACCATGAGG + Intergenic
1119553214 14:75532323-75532345 ACTGTCCCCCAGCCATCATCAGG + Intronic
1128695258 15:69757230-69757252 ACACTCTCCCATCCACTTTACGG - Intergenic
1129243788 15:74267838-74267860 ACCCTCCCCCATCCCTCCTCCGG + Intronic
1129615799 15:77098094-77098116 ACTCTGTCCTATCCTTCATCAGG - Intergenic
1132869240 16:2108326-2108348 ACTCGCTCCCATCCAGCACCAGG + Exonic
1134550293 16:15135723-15135745 ACTCGCTCCCATCCAGCACCAGG + Intronic
1134718175 16:16367272-16367294 ACTCGCTCCCATCCAGCACCAGG - Intergenic
1134956577 16:18384887-18384909 ACTCGCTCCCATCCAGCACCAGG + Intergenic
1136989075 16:35140941-35140963 AGACTCTCCCACACACCATCTGG - Intergenic
1141819953 16:86438486-86438508 CACCTCTCCCATCCATCAGCTGG - Intergenic
1142685064 17:1572784-1572806 TCACTCTCCCACCCACCCTCAGG - Intronic
1142687857 17:1588010-1588032 TCACTCTCCCACCCACCCTCAGG - Intronic
1142867077 17:2797632-2797654 GCACTTTGCCATCCATCCTCTGG + Intronic
1147768666 17:42853060-42853082 ACTCTCTCCCATCCAGCAAAAGG - Intronic
1152636451 17:81432527-81432549 CCACCCTCCCACCCATCACCAGG + Intronic
1153499870 18:5737577-5737599 ACTCTCTTCCATCCATAAGCAGG + Intergenic
1155341566 18:24819021-24819043 ACACTGTCCTTTCCAGCATCAGG + Intergenic
1156506596 18:37599735-37599757 ACCCTCTCTCACACATCATCTGG - Intergenic
1156520558 18:37719361-37719383 GCACACTCACATCCATCTTCCGG + Intergenic
1157746980 18:50144497-50144519 TCACTCTCCCATCCAAAAACAGG + Intronic
928014910 2:27646993-27647015 AAACTCTCCCAACCTTCAACAGG - Intronic
931657575 2:64524325-64524347 ACACTCTCCCATCATGCAGCGGG - Exonic
931691186 2:64836259-64836281 ACTCCCTCCCATCCTTCCTCTGG - Intergenic
932791691 2:74659081-74659103 ACACACTCCCTACCAGCATCTGG + Intronic
936509198 2:113131884-113131906 GCACTGTCCCATCCCTCACCAGG + Intronic
936706163 2:115076746-115076768 ACAATCTAACATCCATCAGCAGG - Intronic
941098227 2:161266082-161266104 ACACGCGCCCATCCGCCATCAGG - Intergenic
947088108 2:226478397-226478419 ACACTGCCCCATCCATCCTAGGG - Intergenic
948583880 2:239006394-239006416 ACCCCCGCCCATCCATCCTCTGG + Intergenic
1169162023 20:3388778-3388800 TCCCTCTCCCATCCAGCACCTGG - Intronic
1169308260 20:4513357-4513379 ACATTCTCCCATCCTTCAGCTGG - Intergenic
1174846825 20:53950470-53950492 ACACCCCCCCATCCATACTCAGG + Intronic
1179790295 21:43752432-43752454 CCACTCCCCGATCCATCACCTGG - Intronic
1181092382 22:20482853-20482875 CCACTTTGCCATCCATTATCTGG + Intronic
1181118272 22:20647857-20647879 ACCCTCTCCCCTTCATCAGCTGG + Intergenic
1181918735 22:26302427-26302449 ATACTCTCTCAACCACCATCAGG - Intronic
949375890 3:3390082-3390104 ACACTCTTCACTCCTTCATCTGG + Intergenic
949887135 3:8704951-8704973 ACTCTCTTCCATGCATCACCAGG - Intronic
953570402 3:44067018-44067040 ACACTTACTCATTCATCATCAGG - Intergenic
953930489 3:47003451-47003473 AGACTCTCCCACTCACCATCTGG - Intronic
982541192 4:156673703-156673725 ACAATCTCCCATCCTCCAGCAGG - Intergenic
986786322 5:11117519-11117541 ACACTCTCTCATCCTTCTGCGGG + Exonic
995491914 5:112702535-112702557 ACAATCTGCCATCCATAAGCTGG - Intergenic
997361460 5:133297892-133297914 ACAGTCCCCCATCCCTCATCTGG + Intronic
1001755891 5:174168147-174168169 ACAGTTTCGCATCCATCTTCTGG + Intronic
1009221805 6:60992226-60992248 ACACTTTCCCAGGCACCATCTGG + Intergenic
1011138378 6:84125011-84125033 GCACAATCCCATCCATCTTCAGG + Exonic
1011414641 6:87105053-87105075 GCACTCTACTATTCATCATCTGG + Intergenic
1011830564 6:91366143-91366165 ACACTTTCCCTACCATCATCAGG + Intergenic
1011854250 6:91669065-91669087 ACAATCTACTATCCATCTTCAGG - Intergenic
1012242421 6:96888594-96888616 TCCTTCTCCCTTCCATCATCTGG + Intergenic
1018437510 6:163776108-163776130 AGACTATCCCATCCATTACCTGG - Intergenic
1019021114 6:168918466-168918488 ACCCTGTCCCATCCATCGTAGGG - Intergenic
1019664782 7:2246386-2246408 ACACTCTCCCAGCCAACGTCAGG - Intronic
1021761494 7:23906390-23906412 TCACTCTCCCTTCCCTCTTCCGG - Intergenic
1026912516 7:74099318-74099340 ACACTCGCCCATTCATTTTCAGG - Intronic
1028710698 7:93904356-93904378 ATAATCTCCCAGGCATCATCAGG + Intronic
1028998921 7:97131905-97131927 ATACTAACCCATCCATCATGTGG - Intronic
1029818525 7:103122348-103122370 ACACTCTCCATGCCATCATTTGG - Intronic
1033319352 7:140325916-140325938 CAACTCTTCCTTCCATCATCTGG - Intronic
1036760179 8:11503308-11503330 ACAAGCTCCCATCCAAGATCAGG - Intronic
1037606772 8:20444479-20444501 ACAGGGTCCCATCCATCATATGG + Intergenic
1037855242 8:22367094-22367116 GCCCGCTCCCATCCTTCATCCGG - Intergenic
1046055484 8:109073357-109073379 TCACTCTCCCATAAATCAGCTGG - Intergenic
1048176521 8:132157526-132157548 ACACTCTCCCAGCCAGCCACTGG - Intronic
1048434010 8:134399040-134399062 AGACTCACCAATCCATCATGAGG - Intergenic
1049949171 9:627707-627729 GCACTCTCCCATCCACCCTCTGG - Intronic
1051779960 9:20679376-20679398 ACGCCCACCCATTCATCATCAGG - Intronic
1053346013 9:37378749-37378771 CCACTGGCCCATCCACCATCCGG + Intergenic
1054713073 9:68530690-68530712 CCACCCTCCCCTCCACCATCTGG - Exonic
1055469267 9:76595197-76595219 ACACTCTCTCTTCCCTCCTCTGG - Intergenic
1055859920 9:80737027-80737049 TCACTGTCCTATCCAGCATCCGG - Intergenic
1058438300 9:104984459-104984481 CCACTCTTCCATCCATAACCAGG - Intergenic
1062512619 9:136915598-136915620 ACACTCTGCCATCTTCCATCAGG + Intronic
1186800588 X:13088598-13088620 ACATTCTCACTTCCATCATGTGG + Intergenic
1186868441 X:13744987-13745009 AAGTTCTCCCATCCATGATCTGG + Intronic
1190339637 X:49286407-49286429 TCACCCTCCCCTTCATCATCAGG - Exonic
1190618413 X:52262107-52262129 ACACTCTCCCAGCCAGCCCCTGG + Intergenic
1195276995 X:103291489-103291511 AAACTCTCTCATCAACCATCTGG - Intergenic
1196005780 X:110835687-110835709 ACAGTCTCCAAGCCCTCATCAGG + Intergenic
1196653157 X:118189304-118189326 ACACTCTTGTAACCATCATCAGG + Intergenic
1197258924 X:124294985-124295007 ATACTCTCCAATACTTCATCTGG - Intronic
1200760672 Y:7036073-7036095 ACACACTCCCATCCCTACTCTGG - Intronic
1201501651 Y:14650099-14650121 AGACTATCCCATCCTTCATAGGG + Intronic