ID: 1090981119

View in Genome Browser
Species Human (GRCh38)
Location 11:131723355-131723377
Sequence CGTAATCTACATCGCTTGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 15
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 14}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090981119_1090981122 11 Left 1090981119 11:131723355-131723377 CCGCTCAAGCGATGTAGATTACG 0: 1
1: 0
2: 0
3: 0
4: 14
Right 1090981122 11:131723389-131723411 CCAGAATTCAGTCTTCTCCATGG 0: 1
1: 0
2: 2
3: 35
4: 316
1090981119_1090981124 26 Left 1090981119 11:131723355-131723377 CCGCTCAAGCGATGTAGATTACG 0: 1
1: 0
2: 0
3: 0
4: 14
Right 1090981124 11:131723404-131723426 CTCCATGGAGGTTTCCTATATGG 0: 1
1: 0
2: 0
3: 10
4: 82
1090981119_1090981123 14 Left 1090981119 11:131723355-131723377 CCGCTCAAGCGATGTAGATTACG 0: 1
1: 0
2: 0
3: 0
4: 14
Right 1090981123 11:131723392-131723414 GAATTCAGTCTTCTCCATGGAGG 0: 1
1: 0
2: 1
3: 23
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090981119 Original CRISPR CGTAATCTACATCGCTTGAG CGG (reversed) Intronic
1083838398 11:65287957-65287979 CTTAATCTACATCTTTGGAGAGG + Intronic
1090981119 11:131723355-131723377 CGTAATCTACATCGCTTGAGCGG - Intronic
1115903731 14:38183936-38183958 TGTAAGCTAGATCTCTTGAGGGG + Intergenic
1119034397 14:71217458-71217480 TGTAATCCCCATCCCTTGAGTGG - Intergenic
1127652897 15:61026259-61026281 GGTAATCTACATAGCTTTAACGG - Intronic
1132214716 15:100054122-100054144 CGGAATCTACAGCCCCTGAGTGG + Intronic
1163927933 19:20363127-20363149 CGAAAGCTACACAGCTTGAGTGG + Intergenic
1184896720 22:47411867-47411889 TGAAAACTACATCACTTGAGAGG + Intergenic
967484934 3:190019226-190019248 CTTAATCTCCATTGCCTGAGAGG - Intronic
973101363 4:46275341-46275363 CATAATCTACAACATTTGAGAGG + Intronic
974762745 4:66299652-66299674 AGTCATGTACATCTCTTGAGTGG + Intergenic
978548936 4:109903477-109903499 CATAATCTCCAACACTTGAGAGG + Intergenic
1013628857 6:111965297-111965319 CTAAATCTACATCTCCTGAGAGG - Intergenic
1033771743 7:144559886-144559908 TGTAATCTACATAACTTGAAAGG - Intronic
1035111325 7:156484484-156484506 CGTAACTTACATAGCCTGAGGGG - Intergenic