ID: 1090981203

View in Genome Browser
Species Human (GRCh38)
Location 11:131724202-131724224
Sequence GGTGAGGGGTGCAGGCGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 492
Summary {0: 1, 1: 1, 2: 2, 3: 44, 4: 444}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090981203_1090981209 4 Left 1090981203 11:131724202-131724224 CCAGGGCGCCTGCACCCCTCACC 0: 1
1: 1
2: 2
3: 44
4: 444
Right 1090981209 11:131724229-131724251 CTGCTTGTCTGATACGTAGCTGG 0: 1
1: 0
2: 0
3: 5
4: 62
1090981203_1090981210 7 Left 1090981203 11:131724202-131724224 CCAGGGCGCCTGCACCCCTCACC 0: 1
1: 1
2: 2
3: 44
4: 444
Right 1090981210 11:131724232-131724254 CTTGTCTGATACGTAGCTGGAGG 0: 1
1: 0
2: 0
3: 2
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090981203 Original CRISPR GGTGAGGGGTGCAGGCGCCC TGG (reversed) Intronic
900123650 1:1059916-1059938 GTGGAGGGGGGCAGGCGTCCAGG - Intergenic
900410063 1:2508369-2508391 GGTGAGAGACGCAGGGGCCCGGG + Intergenic
900512446 1:3067071-3067093 GGTGGGAGGTGCTGGAGCCCAGG - Intergenic
900512747 1:3068251-3068273 GCGGAGAGGTGCGGGCGCCCTGG + Intergenic
900522325 1:3111635-3111657 GGTCAGGGGCGCACGCCCCCTGG + Intronic
900649522 1:3724031-3724053 GGTGGGGGGTGCAGGGGACTGGG + Intronic
901490991 1:9596102-9596124 GGTGTGGGGTCCATGAGCCCCGG - Intronic
901513384 1:9729700-9729722 GGTGTGGGGTGCGGGGTCCCTGG - Exonic
902478904 1:16701573-16701595 GGGTAGGGCTGCAGGGGCCCTGG - Intergenic
903017032 1:20367794-20367816 GTTAAGGGGGGCAGGAGCCCAGG - Intergenic
903674759 1:25056629-25056651 TGTGGGGGGTGCAGGTGGCCAGG + Intergenic
903972799 1:27129995-27130017 GGTGTGGGGAGCAGGAGCCCTGG + Intronic
903976718 1:27154889-27154911 GGGCAGGGGTCCAGGCGCGCCGG + Exonic
904003572 1:27351555-27351577 GGTGAGGAGTGCTGGCCCTCCGG + Exonic
904215479 1:28915081-28915103 GGTGCGGTGTGCAGGAGCCTCGG + Intronic
904337261 1:29805991-29806013 GGTGAAGGGTGCAGGCCTCGGGG + Intergenic
904528745 1:31154859-31154881 GGTGGGGGGTGGAGACGCCCAGG + Intergenic
904869473 1:33607681-33607703 TCTGAGGGGAGCAGGTGCCCCGG + Intronic
905028204 1:34865542-34865564 GGGGAGAGGCCCAGGCGCCCTGG + Exonic
905285951 1:36880576-36880598 GTTGAGGGGGGCAGAGGCCCAGG - Intronic
906171305 1:43728008-43728030 GATGAGGGGTGAAGGCGCAAGGG - Intronic
907401759 1:54228864-54228886 TGTGAGGGGTGCAGAGGGCCAGG - Intronic
907569335 1:55468494-55468516 GGAGAGGGGAGCAGGGGCTCTGG - Intergenic
912330734 1:108818032-108818054 AGTGAGGGGTGCAGGGCCACTGG + Intronic
914915308 1:151815841-151815863 GGTCAGGCCTGCAGGCTCCCTGG + Intronic
915595556 1:156894630-156894652 TGTGGGGGGTCCAGGAGCCCAGG + Intronic
915905274 1:159872652-159872674 GTTGGGGGGTGCAGGCCCCCAGG - Intronic
915977441 1:160400511-160400533 GGTGGGGGGTGCAGGGGGCGGGG - Intergenic
916680001 1:167095032-167095054 GGTGATGGCTGCAGGCTCCCTGG - Intronic
918597075 1:186306852-186306874 GGTGGTGGGTGCAGGCTCCTTGG - Exonic
918597087 1:186306897-186306919 GGTGGTGGGTGCAGGCTCCTTGG - Exonic
918597101 1:186306945-186306967 GGTGGTGGGTGCAGGCTCCTTGG - Exonic
918597108 1:186306969-186306991 GGTGGTGGGTGCAGGCTCCTTGG - Exonic
918597120 1:186307014-186307036 GGTGGTGGGTGCAGGCTCCTTGG - Exonic
918597151 1:186307110-186307132 GGTGGTGGGTGCAGGCTCCTTGG - Exonic
918597186 1:186307227-186307249 GGTGGTGGGTGCAGGCTCCTTGG - Exonic
918597200 1:186307275-186307297 GGTGGTGGGTGCAGGCTCCTTGG - Exonic
918597236 1:186307413-186307435 GGTGGTGGGTGCAGGCTCCTTGG - Exonic
919479438 1:198069342-198069364 TGTTAGGGAAGCAGGCGCCCAGG - Intergenic
920037330 1:203074848-203074870 GGTGAGGGGGGCAGGTGGCAGGG + Intronic
920150297 1:203900610-203900632 GCTGAGGAGTGCGGGCGCACGGG + Intergenic
922526522 1:226308748-226308770 GGCGAGTGGTGCAGGCGGCGAGG + Intronic
922533617 1:226363624-226363646 GGTGAGTGGAGGAGGCGGCCTGG + Intronic
922541673 1:226424951-226424973 GGTGAGAGGTGATGGCGGCCTGG + Intergenic
922765265 1:228153074-228153096 GGGGAGGGGTGCTGGCCCCCAGG - Intronic
923019879 1:230155091-230155113 GGTGGGGGGTGCATGCGGCGCGG - Intronic
1063364216 10:5480089-5480111 GGAGTGTGGTGCAGGCGCCGTGG - Intergenic
1063365644 10:5488718-5488740 GGTCAGCGGTGGGGGCGCCCAGG - Intergenic
1063371592 10:5525920-5525942 GCTGAGGGCTGCAGCCCCCCTGG - Exonic
1063508244 10:6621416-6621438 GGAGAGGGGGCCAGGAGCCCTGG + Intergenic
1065965778 10:30769413-30769435 GCTGAGGAGTGCAGGCGCTGTGG - Intergenic
1067007097 10:42674452-42674474 GGTCAGGGGTGGAGAAGCCCTGG + Intergenic
1067099244 10:43322794-43322816 GGTGAGGGGCGGAGGGGCCACGG - Intergenic
1067111937 10:43407453-43407475 GGGGAGGGGTTCCCGCGCCCGGG + Intronic
1067432014 10:46251238-46251260 GCTGAGGGGTGAAGGAGGCCTGG - Intergenic
1067527618 10:47047966-47047988 GCTGAGGGGTCCAGGAGCCCTGG - Intergenic
1068360616 10:55972368-55972390 GGTGGGGGGTGCTTGCCCCCAGG - Intergenic
1069749558 10:70736575-70736597 TGTGATGAGTGCAGGCACCCAGG - Intronic
1070314252 10:75295268-75295290 GGAGAGGTGTGAGGGCGCCCCGG - Intergenic
1070717762 10:78734920-78734942 GGTGAGTGGTGCAGGTGGCTGGG - Intergenic
1070831823 10:79422424-79422446 GGGGAGGGGTGCAGGGGCTGGGG + Intronic
1071332250 10:84571568-84571590 GCTGAGGAGTGCAGGCGCATGGG + Intergenic
1073080068 10:100854098-100854120 GGTGAGGGGTTGAGGGGCCCGGG - Intergenic
1073193127 10:101666458-101666480 GAGGAGGGGTGCAGGCTCCATGG + Intronic
1073921651 10:108466327-108466349 GCTGTGGGGGGCAGGCGCTCAGG + Intergenic
1075424668 10:122332336-122332358 GGTGAGGGGGGCAGGGGTCAAGG + Intronic
1075464754 10:122642999-122643021 GGTGAGGTGTGCAGGAGGCAGGG + Intronic
1075871381 10:125774321-125774343 GGTCAGGGGTGTGGGCGGCCTGG - Exonic
1076373782 10:129970652-129970674 GGCGATGGGTGCCGGCGGCCGGG + Intergenic
1076613603 10:131742505-131742527 GGTGGGAGGTGCTGGGGCCCAGG - Intergenic
1076797006 10:132803259-132803281 GTTGTGGGGTGCAGGCTCCGCGG + Intergenic
1076873468 10:133204833-133204855 TGTGAGGGGTTCACGTGCCCAGG - Intronic
1076946100 10:133651508-133651530 GGTGAGTGGGGCAGGGGCCGGGG - Intergenic
1077394618 11:2314971-2314993 GGGGAAGGGTGCAGGCGTCCTGG + Intronic
1077459598 11:2702148-2702170 GGTCAGGGGAGCAGGATCCCAGG + Intronic
1077679284 11:4224153-4224175 GGTGGGGGGTGCTTGCACCCAGG + Intergenic
1077688717 11:4320795-4320817 GGTGGGGGGTGCTTGCACCCAGG + Intergenic
1079056001 11:17207505-17207527 GGGGAGGGGGGCCGGCGGCCGGG + Intronic
1079406974 11:20156308-20156330 GGCGAGGGGGGCAGCGGCCCTGG + Exonic
1079658015 11:23005657-23005679 GGTAAGGGGTGCAGACGGGCAGG + Intergenic
1082005678 11:47417869-47417891 GGTGAGGGGGGCAGCCGGCTGGG - Intergenic
1083170542 11:60921829-60921851 GCTGTGGGGAGCAGGGGCCCTGG + Exonic
1083173473 11:60936016-60936038 GGTGAGTGGGGCAGGCGCCGAGG + Exonic
1083324191 11:61865277-61865299 GGTGAGGGGTGGAGGTCCACAGG + Exonic
1083660075 11:64247792-64247814 GGGCGGGGGTGCAGGAGCCCCGG - Intergenic
1083878414 11:65536789-65536811 GCTGAGAGCTGCAGGCACCCAGG + Intronic
1084091150 11:66880098-66880120 TAGGAAGGGTGCAGGCGCCCTGG - Intronic
1084268705 11:68017935-68017957 GGTGAGGGGGCCAGGCAGCCAGG - Intronic
1084372250 11:68751538-68751560 GGGGAGGGGAAGAGGCGCCCGGG + Exonic
1084492727 11:69487325-69487347 CGTGAGGGCTGCAGGCCACCAGG + Intergenic
1084680229 11:70662512-70662534 GGGGAGGGGTGGGGGCTCCCTGG + Intronic
1085029908 11:73264677-73264699 GGTAAGGGGTGCCGGGGCGCGGG + Intronic
1085251239 11:75145265-75145287 GGTGGGGGGTGCAGGTGCAGTGG - Intronic
1085283199 11:75344219-75344241 GGTGTTGGGTGCTGGCGGCCAGG - Intronic
1085451681 11:76637774-76637796 GGTGAGAGGTCCCGGCCCCCGGG + Intergenic
1086132956 11:83420138-83420160 GGTGGGGGGTGCTTGCCCCCAGG - Intergenic
1086319323 11:85628382-85628404 GGCGAGGGGGGCAGGCCCACAGG + Intergenic
1087077091 11:94135185-94135207 GGTGAGGGAGGCAGGGTCCCCGG - Intronic
1089304173 11:117516426-117516448 GGTCAGGCGGGCAGGGGCCCTGG + Intronic
1089663882 11:120004581-120004603 GGTGAGAAGTGCAGGTGGCCTGG - Intergenic
1089697387 11:120224613-120224635 GGTGGGGGGAGCTGGGGCCCGGG + Intronic
1089760061 11:120716695-120716717 GGTCAGGGGTGCTGGGGGCCTGG - Intronic
1090243887 11:125202295-125202317 GGTGAGGGGTGCAGGGGGCAGGG - Intronic
1090636832 11:128694706-128694728 GGCGGGGGCTGCAGTCGCCCGGG + Intronic
1090669046 11:128933362-128933384 GGTGTGGGCTGCAGCCGCACTGG + Intergenic
1090850011 11:130563887-130563909 TGTGAGGGGAGCAGGGGACCAGG + Intergenic
1090981203 11:131724202-131724224 GGTGAGGGGTGCAGGCGCCCTGG - Intronic
1091213787 11:133887045-133887067 TGTGAGTGGTGCAGGAACCCAGG - Intergenic
1093728714 12:22544225-22544247 GGAGAGGGGCGGAGGCGCGCGGG + Intronic
1093969043 12:25357678-25357700 GGTGAGGGGTGGGGGCGCTGAGG + Intergenic
1094316220 12:29139570-29139592 GGTGGGGGGTGCTTGCCCCCAGG + Intergenic
1095310574 12:40692777-40692799 GGTGCGGGATGCCGGAGCCCTGG + Intronic
1095905069 12:47369162-47369184 GGTGAGGGGGGCTGGGGTCCAGG + Intergenic
1096536375 12:52277768-52277790 AGTGAGGAGTGCAGGGGCACAGG + Intronic
1096771620 12:53939223-53939245 GGTGGGGGGTGCGGGCGGCGGGG - Exonic
1101214352 12:102565620-102565642 GGTGAGGGATGTAGGCCCACGGG + Intergenic
1101492042 12:105218662-105218684 GGGAAGGTGTGCAGGCCCCCGGG + Intronic
1102119483 12:110429427-110429449 GGAGGGGGGTGCTGGCCCCCAGG - Intergenic
1102856957 12:116302479-116302501 GGGGAGAGGGGCTGGCGCCCTGG + Intergenic
1103432785 12:120903299-120903321 GGTGAGGTGGGCAGAGGCCCGGG - Intronic
1103601005 12:122054577-122054599 GGAGAGGGTTGCAGACGCCAGGG + Intronic
1104849883 12:131867786-131867808 GATGAGGAGTACAGGGGCCCGGG + Intergenic
1104850012 12:131868351-131868373 CGTGGAGGGTGCAGGCGTCCCGG - Intergenic
1104944007 12:132407587-132407609 CGGGAGGGGTGCAGGCACCTCGG - Intergenic
1104979918 12:132569214-132569236 GGTGGGGGGGGCAGGCCCCAGGG + Intronic
1105071213 12:133235570-133235592 GGTGAGGGGTGCGGGGGCCGGGG - Exonic
1105071355 12:133235951-133235973 GCTGAGGGGCGCCGGCCCCCGGG - Exonic
1105211350 13:18258888-18258910 GGAGAGAGGTGCAGGAGCTCAGG - Intergenic
1105723017 13:23135047-23135069 GGAGGGGGGTGCTGGCCCCCAGG + Intergenic
1106087660 13:26557823-26557845 AGTGAGGGCTGCGGTCGCCCCGG + Intronic
1107992677 13:45832082-45832104 GGTGTGGGGTGCAGCCACCCAGG + Intronic
1108001524 13:45909538-45909560 GGTGAGGGTGGCAGGATCCCTGG + Intergenic
1109506213 13:63306103-63306125 GCTGAGGAGTGCGGGCGCACTGG + Intergenic
1110318258 13:74134512-74134534 GGGGCGGGGTGGAGGCGCCGCGG - Intergenic
1113427579 13:110222131-110222153 GCTGAGGGGTGCCAGGGCCCTGG - Intronic
1114485912 14:23061534-23061556 GGTGGGGGGTGCAGGGGCCGTGG + Exonic
1119158297 14:72431726-72431748 GGTGATGGGTGCAGGGACCTTGG - Intronic
1119406363 14:74402062-74402084 GATGAGTGGTGCATGTGCCCAGG + Intergenic
1120880107 14:89409021-89409043 TGTGAGAGGTGCAGGCTCCCAGG - Intronic
1121967323 14:98322531-98322553 GGTGAGGGGTTCAGAAACCCAGG + Intergenic
1122266975 14:100551152-100551174 GGGCAGGGGAGCAGGGGCCCCGG - Intronic
1122837719 14:104438197-104438219 CCTGAGGGCTGCAGGCCCCCGGG + Intergenic
1125759595 15:42087765-42087787 GGTGAGGGGTGTCGGCAGCCCGG - Intronic
1127904744 15:63368336-63368358 GGCGAAGGGTGCAGGCACCACGG - Intronic
1129108716 15:73325233-73325255 GGTGAGGGGAGCTGGCTGCCAGG + Intronic
1129271443 15:74421339-74421361 GGTGAGGGCTGCTGGCCCCTGGG + Intronic
1131434491 15:92412191-92412213 GGTGAGGGGTGGAGGCAGGCAGG + Intronic
1132513070 16:353462-353484 CGTGAGGGAAGCAGGCTCCCAGG + Intergenic
1132618215 16:852666-852688 GGAGCGGGGTGAAGGAGCCCGGG + Intergenic
1132786774 16:1661354-1661376 GGTGAGGGGTCCTGGCCTCCTGG + Intronic
1132786791 16:1661393-1661415 GGTGAGGGGTCCTGGCCTCCTGG + Intronic
1132786808 16:1661432-1661454 GGTGAGGGGTCCTGGCCTCCTGG + Intronic
1132786825 16:1661471-1661493 GGTGAGGGGTCCTGGCCTCCTGG + Intronic
1132786842 16:1661510-1661532 GGTGAGGGGTCCTGGCCTCCTGG + Intronic
1132869951 16:2111557-2111579 GGTGAGCGGTGCGGCGGCCCAGG - Exonic
1133216271 16:4294275-4294297 GGGAAGGGGCACAGGCGCCCAGG + Intergenic
1133225084 16:4337129-4337151 GGTGGGGGGGGCATGGGCCCTGG + Exonic
1133229215 16:4358550-4358572 AGTGAGGGGTGCCGGCACCCTGG - Intronic
1134009704 16:10842942-10842964 GGTGAGGGGTGGAGGCTGGCAGG + Intergenic
1134717470 16:16364044-16364066 GGTGAGCGGTGCGGCGGCCCAGG + Intergenic
1134957282 16:18388115-18388137 GGTGAGCGGTGCGGCGGCCCAGG - Intergenic
1136428449 16:30184049-30184071 GGTGAGCGGGGCAGCTGCCCTGG + Intronic
1136553292 16:30993108-30993130 GGTGAGCGGGGCAGGCGGCCTGG - Exonic
1137606115 16:49787904-49787926 GACGAGGGGTGCAGGGGCTCAGG - Intronic
1137625155 16:49903093-49903115 GGTGAGAGGTGTTGGAGCCCGGG + Intergenic
1138563603 16:57816652-57816674 GGGGAGGGGTGGAGGCTGCCTGG - Intronic
1138688837 16:58749196-58749218 GTTGATGGGACCAGGCGCCCTGG - Intergenic
1139073418 16:63413316-63413338 TATAAGGGGTGCAGGAGCCCTGG + Intergenic
1139537524 16:67586884-67586906 CGGGAGGATTGCAGGCGCCCAGG - Intronic
1139630800 16:68230906-68230928 GGTGGGGGCAGCAGGCACCCTGG + Exonic
1139703773 16:68726287-68726309 GGTCAGGGGAGCAGGTGACCAGG - Intergenic
1140475637 16:75238160-75238182 GGTGAGGGGTCCTGTGGCCCTGG - Intronic
1141111437 16:81274004-81274026 AGCAAGGGGTGCAGGCGCCCAGG - Intronic
1141897544 16:86968067-86968089 GGTGGGGGGTGGGGGGGCCCAGG + Intergenic
1142136418 16:88453770-88453792 GGTGAAGGTCGCCGGCGCCCAGG - Intronic
1142145399 16:88490896-88490918 GGTGGGGGTTCCAGGCGCCATGG + Intronic
1142240293 16:88941675-88941697 GTTGAGGGGTGCGGGCGCCGTGG + Intronic
1142287581 16:89177655-89177677 GGTGAGGGCAGCAGGGGCCAGGG - Intronic
1142349660 16:89574420-89574442 GGCAAAGGGTGCGGGCGCCCAGG - Intergenic
1142394323 16:89822922-89822944 GGAGAGGAGTGCAGGGCCCCAGG - Intronic
1142671934 17:1491537-1491559 GGTGTGGGGAGCGGGCGGCCGGG - Intronic
1142973694 17:3630393-3630415 GGGGAGGGGCGCAGGCCTCCCGG + Intronic
1143268595 17:5659045-5659067 GGTGAGGGGTGAAGCCTCCCTGG - Intergenic
1143299584 17:5899701-5899723 CATCAGGGGTGCAGGAGCCCCGG - Intronic
1143389940 17:6554430-6554452 AGTGTGGGGGGCAGGAGCCCAGG + Intronic
1143615106 17:8045001-8045023 GGTGAGGGGTGCAGGGATCTTGG + Exonic
1143651209 17:8265217-8265239 GGCCAGGGGTGCAGGCGGACTGG - Intronic
1143684736 17:8504647-8504669 GGAGAGGTCGGCAGGCGCCCGGG + Intronic
1143889403 17:10091067-10091089 ATTGAGGGGAGCAGGAGCCCTGG - Intronic
1143897140 17:10145147-10145169 GCTCAGGGCTGCAGACGCCCTGG + Intronic
1144730154 17:17521371-17521393 TGTGATGGCTGCAGGCGACCTGG - Intronic
1145990627 17:29077399-29077421 GGGGAGGGGAGCTGCCGCCCTGG - Exonic
1145993383 17:29092321-29092343 GGTGAGGGGCCAAGGTGCCCGGG - Exonic
1146063392 17:29618452-29618474 GGAGAGGGGTCCAGGAGCTCAGG + Intronic
1147606502 17:41776717-41776739 GGTGAGGGGGCCAGGCGCGGTGG + Intronic
1147644457 17:42025521-42025543 GGTGAGTGGGGCAGGTGCCCGGG + Exonic
1147671480 17:42179348-42179370 GTGGAGGGTTGCAGGAGCCCAGG - Intronic
1147721756 17:42543779-42543801 GTTGAGGGCTGGAGGCGTCCTGG + Exonic
1148447077 17:47744353-47744375 GGTGAGGGCTGCCTGAGCCCCGG + Exonic
1148622734 17:49046397-49046419 AGGGAGGGCTGCAGGAGCCCAGG + Intronic
1149314027 17:55421959-55421981 GGGGCGGGGCGCAGGAGCCCCGG - Exonic
1149665913 17:58364677-58364699 GGTGAGGGGGGGCGGTGCCCAGG - Intronic
1150151161 17:62809660-62809682 GGTGTGGAGGACAGGCGCCCAGG - Intergenic
1151718914 17:75844800-75844822 GGTGGGGTGTGGTGGCGCCCAGG + Intergenic
1151729244 17:75901160-75901182 GGTGAGCGGGGCAGGAGGCCTGG + Intronic
1152176758 17:78793001-78793023 GGTGAGGGGGGCGGGCGCGGTGG - Intronic
1152298250 17:79480774-79480796 GGTGGGGGCTGCAGTTGCCCAGG - Intronic
1152305721 17:79519230-79519252 CGTGGGGTGTGCAGGCTCCCAGG - Intergenic
1152345531 17:79748469-79748491 GGTCAGGGGTGCCCGCGCCTGGG + Intergenic
1152372011 17:79894544-79894566 GATGGGGGCTGCAGGCTCCCAGG - Intergenic
1152413435 17:80143238-80143260 GGGGAGGGGTGCAGCCTCCAAGG - Intronic
1152610425 17:81312622-81312644 GGTGAGGAGGGCAGTTGCCCAGG - Exonic
1152657759 17:81527873-81527895 GGTCTGGGGTGGAGGCGACCTGG + Intergenic
1152689670 17:81712292-81712314 TGTGCGGGGTGCGGGCGCGCGGG + Exonic
1152804819 17:82350583-82350605 GGCCTGGGGTGCAGGGGCCCCGG + Intergenic
1152878366 17:82801133-82801155 GGTGGGGGAGGCAGGCGCCATGG + Intronic
1153236619 18:2994690-2994712 GGTGAGGAGTGTAGCAGCCCTGG + Intronic
1159889577 18:73940971-73940993 GGTGAGGGTTTCAGACGTCCCGG - Intergenic
1160220760 18:76975922-76975944 GCTGAGAGGTGGAGGGGCCCTGG + Intergenic
1160222086 18:76985009-76985031 GGTGAGTGGTTCAGGAGCCACGG + Intronic
1160535728 18:79590310-79590332 GGTGAGGGGTGAAGGCTTCCAGG + Intergenic
1160727034 19:621917-621939 GGTGAGAGGGGCCGGCTCCCCGG + Intronic
1160837345 19:1131170-1131192 GGTGAAGGATGCAGGAGCCTGGG - Intronic
1160982638 19:1823381-1823403 GTTGAGGGGTGCAGGAGGCCTGG - Intronic
1161056609 19:2193844-2193866 GCAGTGGGGTGCAGGCACCCAGG - Intronic
1161284795 19:3463615-3463637 GGTGGGGGGTGGAGGGGCCGGGG - Intronic
1161569096 19:5020467-5020489 GTTGAAGGGTGCAGCCGCCGTGG - Intronic
1162043573 19:7984741-7984763 GGTGAGGGATGAAGGTGCCCTGG + Intronic
1162151129 19:8646439-8646461 GGTGAGGGGTCCAGGAATCCTGG - Intergenic
1162462245 19:10820089-10820111 GGTGAGGGGCCCAGGGGCCTGGG + Exonic
1162827803 19:13264336-13264358 GGTGAGGGGGGATGGCACCCAGG - Intronic
1162853525 19:13450415-13450437 GGTGAGGGGTGCTGGAAGCCAGG - Intronic
1163118219 19:15200658-15200680 GGGAAGGGGCGCAGGAGCCCCGG - Intronic
1163138652 19:15331972-15331994 GGTGGGGGGCGCGGGCGCCGCGG - Intronic
1163320616 19:16572428-16572450 GGGCGGGGGGGCAGGCGCCCCGG + Intronic
1163664760 19:18598120-18598142 GGAGAGGGGAGGGGGCGCCCAGG - Intronic
1163715937 19:18872161-18872183 GGTGATGGGTGCCCCCGCCCTGG + Intronic
1164587275 19:29483915-29483937 AGTGATGGGTGCAGGCAGCCGGG + Intergenic
1164731272 19:30506633-30506655 GGTGTGGGGTGCATGTGCGCTGG + Intronic
1165322446 19:35094339-35094361 GGTGGTAGGTGCAGGTGCCCTGG - Intergenic
1167004559 19:46767135-46767157 GCTGAGGGGTGCAGGAGCCCGGG - Intronic
1167034722 19:46988334-46988356 GGTGAGGGAGGCATGTGCCCGGG - Intronic
1167250229 19:48395385-48395407 GGCGAGGGGTGCTGGGGGCCTGG - Intronic
1167257959 19:48442537-48442559 GGGGAGGCGGGCAGGCGTCCTGG + Intronic
1167898625 19:52601671-52601693 GGCGAGGGTGGGAGGCGCCCAGG - Intronic
1167903284 19:52637975-52637997 GGCGAGGGTGGGAGGCGCCCAGG + Intronic
1167946498 19:52992949-52992971 GGTGAGGGTGGGAGGCGCCCAGG + Intergenic
1168206780 19:54856106-54856128 GGTCAGGGCTCCAGGCACCCAGG + Intronic
1168269498 19:55241851-55241873 GGTGAGGGGTGGAGGCGGGAAGG + Intronic
1168274001 19:55266083-55266105 GGAGTGGGGAGCAGACGCCCTGG - Intronic
1168408153 19:56121265-56121287 GGTCAGGGGGACGGGCGCCCAGG + Exonic
1202712945 1_KI270714v1_random:27480-27502 GGGTAGGGCTGCAGGGGCCCTGG - Intergenic
924998772 2:387019-387041 GGTGAGGGGGGCAGAAGCCCAGG - Intergenic
925902874 2:8521113-8521135 GGTGGGGCTTGCAGGGGCCCAGG - Intergenic
926135512 2:10332964-10332986 GGTGAGGGGTGCAGGGGGGAGGG + Intronic
926543060 2:14204952-14204974 GGTGAGAGGTGCAGGAGCCAAGG - Intergenic
926630033 2:15127848-15127870 GGTCAGGGGCTCAGGTGCCCAGG - Intergenic
927496966 2:23557551-23557573 GGTGCGGGGTGCTGGGGCCTGGG + Intronic
927606695 2:24491946-24491968 GGCGTGGGGAGCGGGCGCCCCGG + Exonic
927652412 2:24920378-24920400 GGCGAGAGGTGGAGGGGCCCGGG + Intergenic
927990338 2:27442763-27442785 GGTGAGCGCGGCAGGCGACCCGG + Exonic
928373832 2:30759404-30759426 GCTGAGGGCTGCCGGCTCCCGGG - Intronic
929603744 2:43221120-43221142 GGTGAAGACTGCAGGCTCCCTGG - Intergenic
931678417 2:64721068-64721090 GGGGAGGGGAGCAGGACCCCTGG + Intronic
932167546 2:69522077-69522099 TGTGAGGGGTGCAGAAGCCCAGG + Intronic
932503746 2:72208706-72208728 GGTAAAGGGTGCAGGTACCCTGG - Intronic
932621062 2:73265208-73265230 GGAGGGGGGTGCAGGAGCCCAGG + Intronic
932757305 2:74417608-74417630 GGAGGGGGGTGCTGGCCCCCAGG - Exonic
932758445 2:74424512-74424534 TGTTGGGGGTGCAGGGGCCCAGG + Intronic
933728398 2:85438918-85438940 GGGGAGTGGTGAAGGCTCCCTGG - Intergenic
933893207 2:86789618-86789640 GGTGAGGCGTGCGGGGGCCCGGG - Exonic
934567082 2:95346929-95346951 CGTGCGGGCTGCAGGGGCCCCGG + Intronic
934770347 2:96903727-96903749 GGTGAGAGGTCCAGGGGCCAGGG - Intronic
934770862 2:96906976-96906998 GGTGAGGGGAGCAGGCAGGCCGG + Intronic
935274915 2:101467778-101467800 GGTGAGTGGTGAAGGTGGCCTGG + Intronic
935896782 2:107747329-107747351 GCTGAGGAGTGCGGGCGCACGGG - Intergenic
936480465 2:112880428-112880450 TGTGAGGGGAGCTGGGGCCCAGG - Intergenic
937274445 2:120674903-120674925 GGTGAGTGTTGCAGGCGCCCTGG - Intergenic
937343151 2:121104766-121104788 GGTGAAGGGGGCTGGCTCCCAGG + Intergenic
937920806 2:127128725-127128747 GGCAACCGGTGCAGGCGCCCTGG + Intergenic
938252118 2:129823268-129823290 GGTGAGAGGAGCAGGAGGCCAGG + Intergenic
939153935 2:138502159-138502181 GGGGAGGGGAGCAAGCGCCTGGG - Intronic
941026333 2:160460285-160460307 GCTGAGTGGTGAAGGCACCCAGG - Intronic
941603005 2:167563650-167563672 GGTGGGGGGGTCAGCCGCCCCGG - Intergenic
942450319 2:176104976-176104998 GGGGTGGGGTGCAGGCAGCCCGG - Intronic
944615238 2:201452240-201452262 GGTGCGGGGAGAGGGCGCCCGGG - Intronic
945080954 2:206085729-206085751 GGTGAGTGGGGCCGGCGCCCGGG - Intronic
946978575 2:225180889-225180911 GGTGATGGATGCAGGAGCACAGG - Intergenic
947720492 2:232366712-232366734 GCTGAGGCGTGCGGGCGCACGGG + Intergenic
947745813 2:232506785-232506807 GGAGAGGGGTCCTGGCCCCCAGG + Intergenic
948466188 2:238152769-238152791 GGTGAGGGTTTCTGGGGCCCTGG + Exonic
948685311 2:239666220-239666242 TGTGACAGGTGCAGGCGCTCTGG - Intergenic
948746174 2:240095743-240095765 GGCCACGGGTGCAGGCGCCCTGG + Intergenic
948850246 2:240702162-240702184 GGAGAGGGCTGCAGGGTCCCAGG + Intergenic
1168760725 20:347873-347895 GGGGCGGGGCGCAGGCACCCGGG - Intronic
1169118336 20:3081481-3081503 GGGGAGGGGTGGAGGGGCCAAGG + Intergenic
1171795981 20:29567210-29567232 GGTGAGGGGAGCACGCGGCGAGG + Intergenic
1172589241 20:36105853-36105875 GGGGAGGGGTGGAGTCACCCAGG + Intronic
1173452007 20:43173118-43173140 GGTGAAGAGTGCAGGCTCTCCGG - Intronic
1173924833 20:46773117-46773139 GGTGAGAGCTGCAGGCACCCTGG + Intergenic
1174354964 20:49991349-49991371 TGTGAGGGTTGCTGGAGCCCAGG + Intergenic
1174358966 20:50016060-50016082 GGTGAGGAGAGCAGGCGCCGGGG - Intergenic
1174526391 20:51175325-51175347 GATGAGGGCTGCAGGTGCACTGG + Intergenic
1175256740 20:57652412-57652434 GCTGGAGGGTGCAGGGGCCCTGG + Exonic
1175310872 20:58010921-58010943 GCTGAAGGCTGCAGGCTCCCAGG - Intergenic
1176029817 20:63006556-63006578 GGCGCGAGGTGCAGGCGCCGCGG + Exonic
1176238046 20:64063384-64063406 GGTGAGGGGCGCGGGCCGCCAGG + Exonic
1176267832 20:64219979-64220001 GGAGGTGGGTGCAGGCGCCTGGG + Exonic
1176376776 21:6090666-6090688 GGTCAGGAGTGCAGGCGCTGGGG - Intergenic
1179213812 21:39349276-39349298 GGAAAGGGGTGGGGGCGCCCGGG - Intronic
1179496947 21:41778176-41778198 GGCGGGGGGCGCAGGCGGCCCGG - Intergenic
1179504759 21:41833070-41833092 GGAGAGGGGTGCAGGGCACCTGG + Intronic
1179746699 21:43447578-43447600 GGTCAGGAGTGCAGGCGCTGGGG + Intergenic
1179839113 21:44058797-44058819 GGCGAGGGGAGCAGGTGGCCAGG + Intronic
1180006764 21:45026256-45026278 CGTGAGGGGTGCATGAGCACTGG + Intergenic
1180027814 21:45178316-45178338 GGGGAGGGGTGCAGGTGGGCAGG + Intronic
1180082671 21:45493870-45493892 CCTGTGGGGTGCAGGAGCCCAGG + Intronic
1180764886 22:18340550-18340572 GGAGAGAGGTGCAGGAGCTCAGG + Intergenic
1180814144 22:18779134-18779156 GGAGAGAGGTGCAGGAGCTCAGG - Intergenic
1180980751 22:19876977-19876999 TGGCAGGGGTGCAGGAGCCCTGG - Intronic
1181036298 22:20171402-20171424 GGGGAGGGGTGCAAGGGCCAAGG + Intergenic
1181200329 22:21213469-21213491 GGAGAGAGGTGCAGGAGCTCAGG - Intronic
1181683042 22:24509079-24509101 GGTGAGGGGTTCAGCCTCACCGG + Intronic
1181701409 22:24623490-24623512 GGAGAGAGGTGCAGGAGCTCAGG + Intronic
1181807871 22:25385931-25385953 GGTGAGGGAAGCAGGCGAACAGG + Intronic
1181911960 22:26245368-26245390 GAACAGGGGTGCAGGCTCCCAGG + Intronic
1182335497 22:29580928-29580950 GGGGTGGGGTGCAGGCGCGGGGG - Intronic
1182623599 22:31630778-31630800 AGTGAGCGGAGCCGGCGCCCCGG - Intronic
1183259993 22:36788416-36788438 GGATGGGGGTGCAGGCCCCCCGG + Intergenic
1183358824 22:37372997-37373019 GGGGAAGGGTCCAGGCGGCCAGG - Exonic
1183482549 22:38073092-38073114 GGTGAGTAGTCCAGGTGCCCAGG + Exonic
1183629625 22:39025349-39025371 GGTGAGAGGTGCAGGGGTCAGGG + Exonic
1185173787 22:49307723-49307745 GGGGAGGGGAGGAGGCCCCCAGG + Intergenic
1185229050 22:49670190-49670212 GCTGAGGAGTGCGGGCGCACGGG - Intergenic
1203226507 22_KI270731v1_random:81455-81477 GGAGAGAGGTGCAGGAGCTCAGG + Intergenic
1203264242 22_KI270734v1_random:4821-4843 GGAGAGAGGTGCAGGAGCTCAGG - Intergenic
950142539 3:10625351-10625373 GGTGAGGGGTGGTGGAGCCAGGG + Intronic
950534778 3:13572472-13572494 GGTCAGGAGTGCAGGCTCCAGGG - Intronic
951706200 3:25546410-25546432 GATGAGAGGTGCTGGGGCCCTGG + Intronic
952886753 3:38017058-38017080 GATGGGGGGTGCAGGGCCCCAGG + Intronic
953439487 3:42905983-42906005 GGGTAGGGGTGCAGGCGGCTGGG - Intronic
953930520 3:47003579-47003601 GGTGAGGGGAGCAGGGGACAAGG + Intronic
954880133 3:53829817-53829839 GGTGAGGAGGGCAAGCACCCAGG - Intronic
955552439 3:60098881-60098903 GGTTAGGGGTGCTGACTCCCAGG - Intronic
961380475 3:126493346-126493368 GCTGAGAGGTGGAGGCGACCTGG + Intronic
961402696 3:126658219-126658241 GGAGAGGGGAGCAGGGGCACTGG + Intergenic
961722854 3:128907855-128907877 GGTGAGGGGTGCTGATGCCTGGG - Intronic
961812348 3:129529111-129529133 GGTGGGGTGTGCAGGAGCCCGGG + Intronic
967274977 3:187765554-187765576 TGTGAGGGGTGCAGGAGGCCTGG - Intergenic
967349295 3:188494286-188494308 GGTGAGGGCTGCAGGAGCTGTGG + Intronic
967904081 3:194486729-194486751 GGTGAGGGAAGGAGGCGCCGCGG + Intronic
968084528 3:195868394-195868416 GGCGTGGGGTGCAGGGGCCGGGG + Exonic
968225598 3:196970059-196970081 GGAGAGCGCTGCAGGGGCCCCGG + Intergenic
968501036 4:950184-950206 GGTGGGGGCTGCAGGTGCCAGGG + Intronic
968563184 4:1295757-1295779 GGTGAGGGGGGCAGAGGCACGGG - Intronic
968642032 4:1719820-1719842 GGTGTCGGGTGGAGGCGCCCAGG - Intronic
971855774 4:32041412-32041434 GCTGAGGGATGCAGGCCCCATGG + Intergenic
973840304 4:54854404-54854426 GGTGATGGGTGCAGGAGGCTTGG - Intergenic
975514240 4:75227340-75227362 GGTGGGGGGTGCAGGGGGCTAGG + Intergenic
975778738 4:77818786-77818808 GGGGAGGTGGGCGGGCGCCCAGG + Intronic
976743380 4:88379223-88379245 GGTGAGGGGCGCGGGGGCCCAGG + Intronic
979349213 4:119627065-119627087 GGTGCTGGGTGGTGGCGCCCCGG - Intronic
980158581 4:129134105-129134127 GGTGGGGGATGCAGGGGCCAGGG + Intergenic
981937092 4:150249897-150249919 TGTGAGGGGTCCAGGCGTCAAGG + Intronic
985449510 4:190052162-190052184 GGTGAGTGGGGCAGGGGCCGGGG - Intergenic
985549988 5:528195-528217 GGTGGGGAGTTCAGGGGCCCCGG + Intergenic
985685524 5:1279741-1279763 GGGGTGGGGTGCAGGAGCCGTGG + Intronic
985703500 5:1387416-1387438 GGTGAGGGGAGGAGGAGGCCAGG + Intergenic
989950625 5:50293188-50293210 GTTGATGGGACCAGGCGCCCTGG - Intergenic
991687957 5:69198978-69199000 GGTGTGGGGTGCAGGAGAGCAGG + Intronic
991947241 5:71911040-71911062 GGTCAGGGGTACAGGAGGCCTGG + Intergenic
993166255 5:84358315-84358337 GGTGCAGGGTGCAGGTGACCTGG - Intronic
993773585 5:91962780-91962802 GGGCAGGGGTGCAGGAGCCAGGG - Intergenic
994188026 5:96837527-96837549 GGTGGGTGGTGCAGGAGCCGAGG + Intronic
995611269 5:113913022-113913044 GGTGAGGGATGCTGGAGCCAGGG - Intergenic
998151806 5:139761828-139761850 GGTGAGGGCTGCAGACAGCCAGG - Intergenic
998154356 5:139776049-139776071 GAGGAGGGGTTCAGGGGCCCTGG + Intergenic
998332719 5:141343882-141343904 GGTGAGGTTGGCAGCCGCCCCGG - Exonic
998566177 5:143217742-143217764 GGTGAGAGGTGAAGGTGGCCTGG - Intronic
999199214 5:149804208-149804230 GGTGTGGGGTGGAGGCGCAGAGG - Intronic
1002352162 5:178590568-178590590 GGGGGCGGGTGCCGGCGCCCGGG - Intergenic
1002465157 5:179404688-179404710 GGTGAGGAGACCAGGTGCCCTGG + Intergenic
1002576851 5:180178909-180178931 GGGGAGGGGCGCAGGTGCCAAGG + Intronic
1002925633 6:1604540-1604562 AGTGCGCGGTGCGGGCGCCCAGG + Intergenic
1004395688 6:15245238-15245260 GGGGAGGGGGGCCGGGGCCCGGG + Intergenic
1005416371 6:25604534-25604556 GGTGAGAGGTGCATGGGGCCAGG - Intronic
1005905981 6:30261547-30261569 GGTGAGGGGTTCTGACCCCCAGG - Intergenic
1006400815 6:33816137-33816159 GGGGAAGGGGGCAGGCGCACAGG + Intergenic
1006474436 6:34245397-34245419 GGAGGGGGGTGCTGGCCCCCAGG + Exonic
1007592003 6:43027506-43027528 GGACAGGGGTGCAGGGGCCATGG + Intronic
1007719591 6:43877192-43877214 GCTGAGTGGTGGAGGCGCCGAGG + Intergenic
1012237563 6:96836994-96837016 GGGGAGGGGGGCGGGCGGCCCGG + Intronic
1012375566 6:98557936-98557958 TGTGAGAGGTGCAGGCCCCGGGG + Intergenic
1017719866 6:157236591-157236613 GGTGAGGGGTGCGGGCGCCCCGG - Intergenic
1018823561 6:167392922-167392944 GGTGAGGGGTGCAGGTGAGGGGG - Intergenic
1019284045 7:215361-215383 GGTGGGGGGAGCAGGGCCCCTGG + Intronic
1019284080 7:215449-215471 GGTGGGGGGAGCAGGGCCCCTGG + Intronic
1019284112 7:215535-215557 GGTGGGGGGAGCAGGGCCCCTGG + Intronic
1019284147 7:215623-215645 GGTGGGGGGAGCAGGGCCCCTGG + Intronic
1019284210 7:215795-215817 GGTGGGGGGAGCAGGGCCCCTGG + Intronic
1019284270 7:215967-215989 GGTGGGGGGAGCAGGGCCCCTGG + Intronic
1019284288 7:216011-216033 GGTGGGGGGAGCAGGGCCCCTGG + Intronic
1019284306 7:216055-216077 GGTGGGGGGAGCAGGGCCCCTGG + Intronic
1019284320 7:216099-216121 GGTGAGGGGAGCAGGGCCCGTGG + Intronic
1019284352 7:216187-216209 GGTGGGGGGAGCAGGGCCCCTGG + Intronic
1019284368 7:216231-216253 GGTGAGGGGAGCAGGGCCCGTGG + Intronic
1019284385 7:216275-216297 GGTGGGGGGAGCAGGGCCCCTGG + Intronic
1019284403 7:216319-216341 GGTGGGGGGAGCAGGGCCCCTGG + Intronic
1019284438 7:216407-216429 GGTGGGGGGGGCAGGGCCCCTGG + Intronic
1019296443 7:278186-278208 GGTGAGTGGTGGATGGGCCCAGG + Intergenic
1019525814 7:1479955-1479977 GGTGAGGCCTGCAGGATCCCCGG + Intronic
1019567773 7:1693108-1693130 CTTAAGGGGTGCAGGCCCCCAGG + Exonic
1020007880 7:4792016-4792038 GGGGAGGGTTGCAAGCGCCATGG + Intronic
1020086561 7:5313607-5313629 GATGAGGGGTGCTGGGGCCAGGG + Exonic
1023177540 7:37448465-37448487 GGTGAGGGCTGCGGGCGCGTCGG - Intronic
1024046552 7:45589397-45589419 GATGAGGGCTGCAGGGGCCTGGG - Intronic
1024056182 7:45661016-45661038 GGTGAGGGGTTCAGGCTCAGGGG + Intronic
1024920205 7:54546525-54546547 GGTGAGGCGGGCGGGCGCCAGGG - Intronic
1025207752 7:57003531-57003553 GATGAGGGGTGCTGGGGCCAGGG - Intergenic
1025664184 7:63573341-63573363 GATGAGGGGTGCTGGGGCCAGGG + Intergenic
1027707248 7:81549868-81549890 GTTGAGGTCTGCAGGCCCCCCGG - Intergenic
1029402100 7:100352925-100352947 GGTGAGGGGTCCAGGAGGGCAGG + Intronic
1029926933 7:104328521-104328543 GGTGAGGAGGGCCGGAGCCCGGG + Intergenic
1032095874 7:128938313-128938335 GGTTTGGGGTGCTGGCGCCCGGG + Intronic
1033121388 7:138669606-138669628 GGTGAGGGGTGGAGTTGCACAGG - Intronic
1033657266 7:143382198-143382220 GGTGAGGGGTAGAGGGACCCCGG + Intronic
1034618105 7:152436107-152436129 CGTGAGGGGCGCCGGCCCCCGGG + Intergenic
1034718700 7:153267517-153267539 GGTGAGGGGTCCCTGGGCCCAGG + Intergenic
1034993184 7:155560853-155560875 TGTCAAGGTTGCAGGCGCCCTGG + Intergenic
1035050365 7:155995312-155995334 GGGGAGGGGGACAGGCTCCCTGG + Intergenic
1035636981 8:1155047-1155069 GGTGAGAGGTGCTGGTGCCCAGG - Intergenic
1036739648 8:11348559-11348581 GGGGAGGGGTGCAGGCTGCCAGG + Intergenic
1037886496 8:22598982-22599004 GGTGGGGGGCGCAGGTGGCCGGG - Intronic
1039574263 8:38611054-38611076 GGGTAGGGGTGGGGGCGCCCTGG + Intergenic
1039679026 8:39708816-39708838 GGTGCAGGGTGCAGGGGCCAAGG + Intronic
1041470984 8:58208831-58208853 GTGGAGGGATGCAGGCTCCCAGG - Intergenic
1041668031 8:60464998-60465020 GGTGAAGGTTACAGGGGCCCAGG + Intergenic
1043640226 8:82441750-82441772 GCTGAGGAGTGCGGGCGCACCGG + Intergenic
1045084730 8:98670267-98670289 GCTGAGGCGAGCAGGTGCCCAGG + Intronic
1047124825 8:121948452-121948474 GCTGAGGAGTGCAGGCACACAGG + Intergenic
1047212841 8:122853796-122853818 GGAGAGTGGTGCAGGTGCCCTGG - Intronic
1047317465 8:123747782-123747804 GGTGACAGGTGCAGGCGGCTTGG + Intergenic
1049412040 8:142477822-142477844 GGTGTGGGGTGGTGGCCCCCAGG + Intronic
1049412073 8:142477917-142477939 GGTGTGGGGTGGTGGCCCCCAGG + Intronic
1049447685 8:142638919-142638941 GAAGAAGGGTGCAGGAGCCCTGG + Intergenic
1050895910 9:10885908-10885930 GGTGGGGGGTGCTTGCCCCCAGG - Intergenic
1051206442 9:14693571-14693593 GGGGAGGGGCAGAGGCGCCCAGG - Intergenic
1056475062 9:86945780-86945802 CGAGTGGGGTCCAGGCGCCCCGG + Exonic
1056512009 9:87315223-87315245 AGTGAGGGGTGCATGCCCACAGG - Intergenic
1056806716 9:89734695-89734717 GGAGAGGGCTGCAAGCGCCCTGG + Intergenic
1057030686 9:91773112-91773134 GCAGAGGGCTGCAGGGGCCCTGG - Intronic
1057042592 9:91858182-91858204 GGTGTGGGGCACAGGAGCCCAGG - Intronic
1057261466 9:93587171-93587193 GGTGAGGGATGGAGGAGCCTCGG + Intronic
1057261550 9:93587456-93587478 GATGAGGGATGGAGGAGCCCCGG + Intronic
1057739113 9:97696818-97696840 GTTTAGGGATGCAGCCGCCCCGG - Intronic
1058723589 9:107781286-107781308 GGTGAGGGGTACAGAGGTCCAGG - Intergenic
1059394898 9:114028122-114028144 GGTGAGGGAGGCAGGGGGCCTGG + Intronic
1060148185 9:121269249-121269271 GGTGAGAGGTCCTGGTGCCCTGG - Intronic
1060478056 9:124000010-124000032 GGGGAGGGGCGCCGGGGCCCGGG - Intergenic
1060811723 9:126614240-126614262 GGCGCGGGCTGCAGCCGCCCCGG + Intergenic
1060819321 9:126652235-126652257 GGAGGGGGCTGCAGGCCCCCAGG + Intronic
1060821115 9:126662039-126662061 GGGGAGGGGTGCAGGGGGCTCGG - Intronic
1060889154 9:127177327-127177349 GGTGAAGGGTGGAGGCACCAGGG - Intronic
1060970022 9:127732517-127732539 GGTGTGGGGTGAAGCTGCCCGGG + Intronic
1061885522 9:133589425-133589447 GGTGAGGGGTGAGGGCTCCAGGG + Intergenic
1061970301 9:134041373-134041395 GGGGTGGGGTGCAGGCTCCAGGG - Intronic
1062255430 9:135618625-135618647 GGTGAGGGAGGAAGGCTCCCTGG + Intergenic
1062327145 9:136017824-136017846 GGTAGGGTGTGCAGGAGCCCAGG - Intronic
1062392694 9:136340270-136340292 GGGGAGGCCTGCAGGTGCCCAGG + Intronic
1062435597 9:136545461-136545483 GGTGTGGGGTGCTGGGGCCCCGG - Intronic
1062444336 9:136587401-136587423 GGTGGGGGGTGCTGGAGACCAGG + Intergenic
1062460140 9:136659543-136659565 GGTGAGGGGTCCGGGAGGCCCGG + Exonic
1062599127 9:137312212-137312234 GGGGTGGGGTGGAGGTGCCCAGG - Intronic
1186673702 X:11793752-11793774 GGTGAGAGGTGGAGGTGCACAGG - Intergenic
1186726534 X:12364627-12364649 GGTGAGGGAGGCAGGAGTCCAGG + Intronic
1190056861 X:47186188-47186210 GGTGAGGGGGTCTGGAGCCCGGG + Intronic
1190094369 X:47467044-47467066 GGTGGGGGATGGAGGCTCCCTGG + Intronic
1190440665 X:50471445-50471467 GATGAGGGAGGCTGGCGCCCCGG + Intergenic
1191136622 X:57070797-57070819 GGCGTGGGGGGCAGGAGCCCAGG - Intergenic
1192321928 X:70096906-70096928 GTTGAGGGGTGCAGTAACCCTGG + Intergenic
1192436946 X:71148780-71148802 GGTGGGGGGTGCATGCCCCTGGG + Intronic
1192656968 X:73002921-73002943 GGTGCGGGGTGCGGGCGGGCAGG - Intergenic
1192665152 X:73080080-73080102 GGTGCGGGGTGCGGGCGGGCAGG + Intergenic
1195314520 X:103664925-103664947 GGTGTGGGGTGAAAGGGCCCTGG + Intergenic
1196196357 X:112841438-112841460 CGGGAGGGGGGCAAGCGCCCGGG - Intergenic
1197581288 X:128287753-128287775 GGTGAGGTTTGCAGGCACTCAGG - Intergenic
1199172283 X:144745680-144745702 GCTGAGGTGTGCAGGGGACCAGG - Intergenic
1199832878 X:151562650-151562672 GCTGAGGAGTGCAGGCGCACTGG - Intergenic
1200064990 X:153499961-153499983 GCTCAGGGGGGCAGACGCCCAGG + Intronic
1200279284 X:154762981-154763003 GGTAAGGGCTGCAGGCTTCCGGG + Exonic
1201468392 Y:14309615-14309637 GCTGAGGAGTGCGGGCGCACGGG + Intergenic
1202202368 Y:22367135-22367157 GCTGAGGAGTGCAGGCACACAGG - Intronic